Previous Contig 011115:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008J10Sequence110011115 (2)
JMFF051N21Sequence635000056 (19)sp|P09189|HS7C_PETHY9e-96Heat shock cognate 70 kDa protein.>pir|S03250|S03250 dnaK-type molecular chapero518011115 (2)gb:AF509339_18070432e-44Saussurea medusa heat shock protein 70 (HSP70) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051N21+ GGATGAGGAACACAAAAAGAAGGTTGAGGCAAAGAATG
                      ____________________________________________________________
consensus GGATGAGGAACACAAAAAGAAGGTTGAGGCAAAGAATG
 
. : . : . : . : . : . :
rJMFF051N21+ CATTGGAGAATTATGCTTACAACATGAGGAACACCATAAAGGATGAGAAGATTGGATCTA
                      ____________________________________________________________
consensus CATTGGAGAATTATGCTTACAACATGAGGAACACCATAAAGGATGAGAAGATTGGATCTA
 
. : . : . : . : . : . :
rJMFF051N21+ AGCTAACCCCAGATGACAAGAAGAAGATTGAGGATGCCATTGATCAAGCAATCTCTTGGT
                      ____________________________________________________________
consensus AGCTAACCCCAGATGACAAGAAGAAGATTGAGGATGCCATTGATCAAGCAATCTCTTGGT
 
. : . : . : . : . : . :
rJMFF051N21+ TAGATAGCAATCAACTTGCTGAAGCTGATGAGTTTGAAGACAAGATGAAGGAGCTTGAGA
                      ____________________________________________________________
consensus TAGATAGCAATCAACTTGCTGAAGCTGATGAGTTTGAAGACAAGATGAAGGAGCTTGAGA
 
. : . : . : . : . : . :
rJMFF051N21+ GCATCTGCAATCCCATCATTGCCAAGATGTACCAGGGTGCGGGAGGTGCCGCTGGAGGAG
                      ____________________________________________________________
consensus GCATCTGCAATCCCATCATTGCCAAGATGTACCAGGGTGCGGGAGGTGCCGCTGGAGGAG
 
. : . : . : . : . : . :
rJMFF051N21+ ACATGGATGAGGATGCCCCGGCTGGTGGTAGTGGTGCTGGCCCCAAGATTGAAGAGGTTG
                      ____________________________________________________________
consensus ACATGGATGAGGATGCCCCGGCTGGTGGTAGTGGTGCTGGCCCCAAGATTGAAGAGGTTG
 
. : . : . : . : . : . :
rJMFF051N21+ ATTAAGGCAACGACTCTTACACTTAAAAGAGTATTACCTTAATATTTCGCGATTGTGAAC
                      ____________________________________________________________
consensus ATTAAGGCAACGACTCTTACACTTAAAAGAGTATTACCTTAATATTTCGCGATTGTGAAC
 
. : . : . : . : . : . :
rJMFF008J10+ TTTTTTTTTTTTTCTTTTTTCGATTCATGAACTCAAT
rJMFF051N21+ TGCTGGATTGGTTATCTTTTCTGTTTTTTTTTTTTTCTTTTTTCGATTCATGAACTCAAT
                      ____________________________________________________________
consensus TGCTGGATTGGTTATCTTTTCTGTTTTTTTTTTTTTCTTTTTTCGATTCATGAACTCAAT
 
. : . : . : . : . : . :
rJMFF008J10+ ATTTCCAGTTTAGATTACGCTTAATGTGAAATACCATCAATTTTTGCGATC
rJMFF051N21+ ATTTCCAGTTTAGATTACGCTTAATGTGAAATACCATCAATTTTTGCGATCTATTCTTAT
                      ____________________________________________________________
consensus ATTTCCAGTTTAGATTACGCTTAATGTGAAATACCATCAATTTTTGCGATCTATTCTTAT