Previous Contig 011111:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028C13Sequence517001311 (2)gb:AF533771_18094701e-40Medicago truncatula lecithine cholesterol acyltransferase-like protein mRNA, com682011111 (2)gb:AE005172_8916266e-38Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC004557_153186
JMFF051M06Sequence615001311 (2)gb:AF533771_18094704e-57Medicago truncatula lecithine cholesterol acyltransferase-like protein mRNA, com565011111 (2)gb:AE005172_8916261e-21Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC004557_153186

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF028C13+ TGGTCGATCCGTTGCAGGTGAGAGAGGAACAGCG
                      ____________________________________________________________
consensus TGGTCGATCCGTTGCAGGTGAGAGAGGAACAGCG
 
. : . : . : . : . : . :
rJMFF028C13+ GAGCTCNGAGAGCAACATGTGGCTGCTGCCGTCGCCGGCGGTGTTCGGCGGCACAAAACC
                      ____________________________________________________________
consensus GAGCTCNGAGAGCAACATGTGGCTGCTGCCGTCGCCGGCGGTGTTCGGCGGCACAAAACC
 
. : . : . : . : . : . :
rJMFF028C13+ GCTTNGTCGTCACGCCGCACGCCGAGTACACGGCGGATGACATCTCCCGGTTTCTGGCGG
                      ____________________________________________________________
consensus GCTTNGTCGTCACGCCGCACGCCGAGTACACGGCGGATGACATCTCCCGGTTTCTGGCGG
 
. : . : . : . : . : . :
rJMFF028C13+ ACATTGGGTTCTCCGGCGGCGTCTCGCGCTACGAATCGCGCGTGTTGCCTCTGGTGGAGC
rJMFF051M06+ TCGCGCGTGTTGCCTCTGGTGGAGC
                      ____________________________________________________________
consensus ACATTGGGTTCTCCGGCGGCGTCTCGCGCTACGAATCGCGCGTGTTGCCTCTGGTGGAGC
 
. : . : . : . : . : . :
rJMFF028C13+ GGTTGGCCGCGCCGCCGGGAGTGCCGGTGACGTGCATATTCGGGAGCGGGGTTGAGACGG
rJMFF051M06+ GGTTGGCCGCGCCGCCGGGAGTGCCGGTGACGTGCATATTCGGGAGCGGGGTTGAGACGG
                      ____________________________________________________________
consensus GGTTGGCCGCGCCGCCGGGAGTGCCGGTGACGTGCATATTCGGGAGCGGGGTTGAGACGG
 
. : . : . : . : . : . :
rJMFF028C13+ CGGAGACGCTGGTTTATGGGGAGGGTGGGTTCGATGAGCAGCCGTAGATTGTGTACGGCG
rJMFF051M06+ CGGAGACGCTGGTTTATGGGGAGGGTGGGTTCGATGAGCAGCCGTAGATTGTGTACGGCG
                      ____________________________________________________________
consensus CGGAGACGCTGGTTTATGGGGAGGGTGGGTTCGATGAGCAGCCGTAGATTGTGTACGGCG
 
. : . : . : . : . : . :
rJMFF028C13+ ACGGCGACGGCACGGTGAATATGGTGAGCTTGACGGCACTTGAGTGGCAATGGGGAAATG
rJMFF051M06+ ACGGCGACGGCACGGTGAATATGGTGAGCTTGACGGCACTTGAGTGGCAATGGGGAAATG
                      ____________________________________________________________
consensus ACGGCGACGGCACGGTGAATATGGTGAGCTTGACGGCACTTGAGTGGCAATGGGGAAATG
 
. : . : . : . : . : . :
rJMFF028C13+ ATACGGTTGAAGTGATCAAGATTCCTGGGGTTTCTCATATGTCAATGGTTAAAGATAAAG
rJMFF051M06+ ATACGGTTGAAGTGATCAAGATTCCTGGGGTTTCTCATATGTCAATGGTTAAAGATAAAG
                      ____________________________________________________________
consensus ATACGGTTGAAGTGATCAAGATTCCTGGGGTTTCTCATATGTCAATGGTTAAAGATAAAG
 
. : . : . : . : . : . :
rJMFF028C13+ GTGCAGTTGATAGAATTCTTGAAGAAATTTCTTCAATCAATTCTAATATTACTACTTCTA
rJMFF051M06+ GTGCAGTTGATAGAATTCTTGAAGAAATTTCTTCAATCAATTCTAATATTACTACTTCTA
                      ____________________________________________________________
consensus GTGCAGTTGATAGAATTCTTGAAGAAATTTCTTCAATCAATTCTAATATTACTACTTCTA
 
. : . : . : . : . : . :
rJMFF028C13+ GCACCCTCGTTTCAACAAGTTGATTGTAAGTTGTTCCAATGACTTATTAATTATGTATTA
rJMFF051M06+ GCACCCTCGTTTCAACAAGTTGATTGTAAGTTGTTCCAATGACTTATTAATTATGTATTA
                      ____________________________________________________________
consensus GCACCCTCGTTTCAACAAGTTGATTGTAAGTTGTTCCAATGACTTATTAATTATGTATTA
 
. : . : . : . : . : . :
rJMFF028C13+ ATTTAGAATTTTAATTTGGTACTAGAGTTAGATATTTCATACTAGTATAAAGTACATGAC
rJMFF051M06+ ATTTAGAATTTTAATTTGGTACTAGAGTTAGATATTTCATACTAGTATAAAGTACATGAC
                      ____________________________________________________________
consensus ATTTAGAATTTTAATTTGGTACTAGAGTTAGATATTTCATACTAGTATAAAGTACATGAC
 
. : . : . : . : . : . :
rJMFF028C13+ ACAATTTCGTTTAATATACTATCCTATTACGGGATAAAAGCTAAGAGT
rJMFF051M06+ ACAATTTCGTTTAATATACTATCCTATTACGGGATAAAAGCTAAGAGTGTTCTCATATAA
                      ____________________________________________________________
consensus ACAATTTCGTTTAATATACTATCCTATTACGGGATAAAAGCTAAGAGTGTTCTCATATAA
 
. : . : . : . : . : . :
rJMFF051M06+ GGGATTATGTTCATTATXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GGGATTATGTTCATTATNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAGG