Previous Contig 011109:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001I19Sequence556006432 (12)691011109 (11)gb:AF110226_17687675e-32Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF003B02Sequence500006432 (12)759011109 (11)gb:AF110226_17687675e-34Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF025E03Sequence525006432 (12)731011109 (11)gb:AF110226_17687676e-33Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF035I16Sequence559006432 (12)762011109 (11)gb:AF110226_17687671e-34Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF047D08Sequence590006432 (12)570011109 (11)gb:AF110226_17687671e-14Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF047P11Sequence590006432 (12)601011109 (11)gb:AF110226_17687679e-23Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFF051M03Sequence558006432 (12)619011109 (11)gb:AF110226_17687679e-26Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMFS096B10Sequence620011109 (11)gb:BVU313093_16431971e-50Beta vulgaris mRNA for salt tolerance protein 2 (sato2 gene).
JMSF027C19Sequence746006432 (12)770011109 (11)gb:AF110226_17687672e-33Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMSF046C11Sequence750006432 (12)gb:AJ786380_12842506e-05Cryptosporidium parvum rop-r gene for repeat organellar protein-related, isolate767011109 (11)gb:AF110226_17687678e-45Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.
JMSF047H17Sequence702006432 (12)gb:AJ786380_12842502e-04Cryptosporidium parvum rop-r gene for repeat organellar protein-related, isolate784011109 (11)gb:AF110226_17687677e-39Nicotiana tabacum nuclear RNA binding protein (RggA) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS096B10- GTCTAAGCAATGGTGATCGCCGTGGTGGTCTAAGCAATGGTGAAAA
                      ____________________________________________________________
consensus GTCTAAGCAATGGTGATCGCCGTGGTGGTCTAAGCAATGGTGAAAA
 
. : . : . : . : . : . :
JMFS096B10- TGCTGATGGGGAATATCCTCGCAGGGCATATGAACGCCGTAGTGGAACAGGGCGTGGGAG
rJMSF046C11+ GGGCGTGGGAG
                      ____________________________________________________________
consensus TGCTGATGGGGAATATCCTCGCAGGGCATATGAACGCCGTAGTGGAACAGGGCGTGGGAG
 
. : . : . : . : . : . :
JMFS096B10- TGAAATTAAGCGTGAGGGTTCTGGTCGCGGAAACTGGGGAAGTCCTACAGATGAGATTGC
rJMSF046C11+ TGAAATTAAGCGTGAGGGTTCTGGTCGCGGAAACTGGGGAAGTCCTACAGATGAGATTGC
rJMSF047H17+ CGGAAACTGGGGAAGTCCTACAGATGAGATTGC
rJMFF003B02+ ACAGATGAGATTGC
rJMFF035I16+ TACAGATGAGATTGC
rJMSF027C19+ TCCTACAGATGAGATTGC
                      ____________________________________________________________
consensus TGAAATTAAGCGTGAGGGTTCTGGTCGCGGAAACTGGGGAAGTCCTACAGATGAGATTGC
 
. : . : . : . : . : . :
JMFS096B10- TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
rJMSF046C11+ TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
rJMSF047H17+ TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
rJMFF003B02+ TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
rJMFF001I19+ TTAATGATGGTGTGACCACTGATGCATT
rJMFF025E03+ GAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
rJMFF035I16+ TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
rJMSF027C19+ TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
                      ____________________________________________________________
consensus TCCTGAAGCTGAAGAGCCCATAAATGGAGTTGTTAATGATGGTGTGAACACTGATGCATT
 
. : . : . : . : . : . :
JMFS096B10- TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMSF046C11+ TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMSF047H17+ TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMFF003B02+ TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMFF001I19+ TGAGAAGCANCATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMFF025E03+ TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMFF035I16+ TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
rJMSF027C19+ TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
                      ____________________________________________________________
consensus TGAGAAGCAACATGGGCAAGAAGATGCTGGAGATGCCAAGAAGGATTCTCCATTGGATGA
 
. : . : . : . : . : . :
JMFS096B10- ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMSF046C11+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMSF047H17+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMFF047P11+ TGAGAAATTGTT
rJMFF003B02+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGTTGACTCTGGATGAGTATGAGAAATTGTT
rJMFF001I19+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMFF025E03+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMFF035I16+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMSF027C19+ ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
rJMFF051M03+ GATGAGTATGAGAAATTGTT
                      ____________________________________________________________
consensus ACCAGAAGTAAAGGAACCTGAGGATAAGGAGATGACTCTGGATGAGTATGAGAAATTGTT
 
. : . : . : . : . : . :
JMFS096B10- GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMSF046C11+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMSF047H17+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMFF047P11+ -GAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMFF047D08+ ATTCTGGCATCAAGGCCTGAGGAAAGAAAGG-TTGCTTAGA
rJMFF003B02+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMFF001I19+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMFF025E03+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMFF035I16+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMSF027C19+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
rJMFF051M03+ GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
                      ____________________________________________________________
consensus GGAGGAGAAGAGAAAGGCTATTCTGGCATCAAGGCCTGAGGAAAGAAAGGTTTGCTTAGA
 
. : . : . : . : . : . :
JMFS096B10- CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMSF046C11+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMSF047H17+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF047P11+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF047D08+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF003B02+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF001I19+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF025E03+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF035I16+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMSF027C19+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
rJMFF051M03+ CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
                      ____________________________________________________________
consensus CAAAGAATTTGAATCCATGGCACTGTTGGCAAATAAGAAGAATGATGATGAGGTCTTTGT
 
. : . : . : . : . : . :
JMFS096B10- TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMSF046C11+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMSF047H17+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMFF047P11+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMFF047D08+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMFF003B02+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMFF001I19+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMFF025E03+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMFF035I16+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
rJMSF027C19+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTCAAAAAAGA
rJMFF051M03+ TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
                      ____________________________________________________________
consensus TAAGTTGGGATCTGAAAAAGAAGATAAAAAGAAAGAGGCCGGAGAAAAGGTC-AAAAAGA
 
. : . : . : . : . : . :
JMFS096B10- CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMSF046C11+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMSF047H17+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF047P11+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF047D08+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF003B02+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF001I19+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF025E03+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF035I16+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMSF027C19+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
rJMFF051M03+ CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
                      ____________________________________________________________
consensus CAAAAAGTATAAACGAATTTCTGAAGCCTGCTGAAGGTGAAACGTACTATCGCCCAGGTG
 
. : . : . : . : . : . :
JMFS096B10- GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGA
rJMSF046C11+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMSF047H17+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF047P11+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF047D08+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF003B02+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF001I19+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF025E03+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF035I16+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMSF027C19+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
rJMFF051M03+ GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
                      ____________________________________________________________
consensus GCCGAGGCAGGGGTCGGGGCCATGGCAGTGGCAGAGGAGGATATGGTGGAAACAATACCA
 
. : . : . : . : . : . :
rJMSF046C11+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMSF047H17+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF047P11+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF047D08+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF003B02+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF001I19+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF025E03+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF035I16+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMSF027C19+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
rJMFF051M03+ GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
                      ____________________________________________________________
consensus GCAGTTTTGAAACCCCATCAATTGAAGACGTTGGTCAGTTCCCTACCTTGGGGTCAAAGT
 
. : . : . : . : . : . :
rJMSF046C11+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMSF047H17+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF047P11+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF047D08+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF003B02+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF001I19+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF025E03+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF035I16+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMSF027C19+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
rJMFF051M03+ GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
                      ____________________________________________________________
consensus GAGGGATCAAGCCATTCCTGCCAAGCTCTCAATTTAAGATATCTTCAGGATTCATGTTCC
 
. : . : . : . : . : . :
rJMSF046C11+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMSF047H17+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF047P11+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF047D08+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF003B02+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF001I19+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF025E03+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF035I16+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMSF027C19+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
rJMFF051M03+ TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
                      ____________________________________________________________
consensus TGTATTATCAGTGTTACAGTAGTGTAAATTTAGAGTTCATCTGGGGGTTCCTTTCCTCAG
 
. : . : . : . : . : . :
rJMSF046C11+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCC
rJMSF047H17+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF047P11+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF047D08+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF003B02+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF001I19+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF025E03+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF035I16+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMSF027C19+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
rJMFF051M03+ TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
                      ____________________________________________________________
consensus TAGTATTGTTAAACTACTCAACTCAACATTCATATCCTTGATCTGTTAGGAGTTCAATTT
 
. : . : . : . : . : . :
rJMSF047H17+ TGATCTGAGTT
rJMFF047P11+ TGATCTGAGTTTGAATTGGAA
rJMFF047D08+ TGATCTGAGTTTGAATTGGAA
rJMFF003B02+ TGATCTGAGTTTGAATTGGAAGCAAT
rJMFF001I19+ TGAT
rJMFF025E03+ TGATCTGAGTT
rJMFF035I16+ TGATCTGAGTTTGAATTGGAAGCAATTT
rJMSF027C19+ TGATCTGAGTTTGAA-TGGAAGCAATTT
rJMFF051M03+ TGATCTGAGTTTGAATTGGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TGATCTGAGTTTGAATTGGAAGCAATTTAAAAAAACTCTCCAGGGTGATCCGCCATAAGG