Previous Contig 011103:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051K22Sequence585005768 (16)pir|T07044|T070441e-79probable epoxide hydrolase (EC 3.3.2.3) (clone EH4.1) - potato>gb:STU02495_17229546011103 (3)gb:STU02496_17229565e-48Solanum tuberosum Lemhi Russet clone EH5.3 epoxide hydrolase mRNA, complete cds.
JMSF018L11Sequence504005768 (16)pir|T07044|T070449e-64probable epoxide hydrolase (EC 3.3.2.3) (clone EH4.1) - potato>gb:STU02495_17229780011103 (3)gb:STU02496_17229569e-94Solanum tuberosum Lemhi Russet clone EH5.3 epoxide hydrolase mRNA, complete cds.
JMSF020D10Sequence681005025 (3)gb:ATAC010870_15431852e-52Arabidopsis thaliana chromosome III BAC T13O15 genomic sequence, complete sequen769011103 (3)gb:STU02496_17229561e-88Solanum tuberosum Lemhi Russet clone EH5.3 epoxide hydrolase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018L11+ CAGTCCATCGCTCCTGAAGAAGACAAAGTGTTCGTTGTGGGTCATGACT
rJMSF020D10+ TGTGGGTCATGACT
                      ____________________________________________________________
consensus CAGTCCATCGCTCCTGAAGAAGACAAAGTGTTCGTTGTGGGTCATGACT
 
. : . : . : . : . : . :
rJMSF018L11+ GGGGTGCACTCATAGCTTGGCAATTGTGCATGTTTAGGCCGGATAAAGTGAAGGCTTTGG
rJMSF020D10+ GGGGCGCAATCATAGCTTGGCATTTGTGTATGTTTAGGCCGGATAAAGTGAAGGCTTTGG
                      ____________________________________________________________
consensus GGGGTGCACTCATAGCTTGGCATTTGTGTATGTTTAGGCCGGATAAAGTGAAGGCTTTGG
 
. : . : . : . : . : . :
rJMSF018L11+ TCAACCTCAGTGTCCAGTTTTTCCCTAGGCGTCCTCATCTGGATCTCGTTGAAAGCTTTA
rJMSF020D10+ TCAACCTCAGTGTCCATTTTTTCCCTAGGCATCCTCATCTGGATCTTGTTGAAGGCCATA
                      ____________________________________________________________
consensus TCAACCTCAGTGTCCATTTTTTCCCTAGGCGTCCTCATCTGGATCTTGTTGAAGGCTTTA
 
. : . : . : . : . : . :
rJMSF018L11+ AGGCCATGTATGGAAATGATCACTACATTTGCAGATTCCAGGAACCAGGAGAGATTGAAG
rJMSF020D10+ GGGCCATGTATGGAAATGATCACTACATTTGCAGATTCCAGGAACCAGGAGAGATTGAAG
                      ____________________________________________________________
consensus GGGCCATGTATGGAAATGATCACTACATTTGCAGATTCCAGGAACCAGGAGAGATTGAAG
 
. : . : . : . : . : . :
rJMSF018L11+ CCGAGTTAGCCCCTATTGGAATCAAAACATGTCTCCAAAA---CATCTTTGCATTCCGCA
rJMSF020D10+ CCGAGTTTGCCCCTATTGGAGTCAAAACATGTCTCCAAAACATCATCTTTGCATTCGGTA
                      ____________________________________________________________
consensus CCGAGTTTGCCCCTATTGGAGTCAAAACATGTCTCCAAAACATCATCTTTGCATTCGGTA
 
. : . : . : . : . : . :
rJMSF018L11+ GACCAGGACCTTTGTATTTTCCTAAAGGCAAAGGTTTTAGTGCAAATACAGATGGTTCAA
rJMSF020D10+ GACCAGAACCTTTGTATTTTCCTAAAGATAAAGGCTT---------TACAGATGGTTCAA
                      ____________________________________________________________
consensus GACCAGGACCTTTGTATTTTCCTAAAGGTAAAGGTTTTAGTGCAAATACAGATGGTTCAA
 
. : . : . : . : . : . :
rJMSF018L11+ CGGCCCTGCCGGCATGGTTGCCGGAGGAAGACTTGGATTATTTCGTCAGCCGGTATGAGA
rJMSF020D10+ CTGCCCTGCCGGCATGGTTGCCGGAGGAAGACTTGGATTATTATGTGAACCGGTATGAGA
rJMFF051K22+ TGGTTGCCGGAGAAAGACTTGGATTATTTTGTCAGCCGGTTTGAGA
                      ____________________________________________________________
consensus CTGCCCTGCCGGCATGGTTGCCGGAGGAAGACTTGGATTATTTTGTCAGCCGGTATGAGA
 
. : . : . : . : . : . :
rJMSF018L11+ AGACAGGCTTCACCGGAGGAGTGAACTACTACCGAGCTTTGAAACTAGACTGGGAGCTAA
rJMSF020D10+ AGACAGGCTTCACCGGAGGAGTTAACTACTACCGAGCTTTGAAACTAGACTGGGAGTTAA
rJMFF051K22+ AGACAGGCTTCACCGGAGGAGTTAACTACTACCGAGCTGCGAATTTGAACTGGGAGCTGA
                      ____________________________________________________________
consensus AGACAGGCTTCACCGGAGGAGTTAACTACTACCGAGCTTTGAAACTAGACTGGGAGCTAA
 
. : . : . : . : . : . :
rJMSF018L11+ CTGCAGCCTGGTCTGAGACAAAAGTGATGGTGCCAACCAAATTCATAGTTGGAGACCTAG
rJMSF020D10+ CTGCACCCTGGTCTGGGTCAAAAGTGATGGTGCCAACCAAATTCATAGTTGGAGACCTAG
rJMFF051K22+ CTGCACCCTGGACTGAGGCAAAAGTGATGGTGCCAACCAAATTCATAGTTGGAGAGCTGG
                      ____________________________________________________________
consensus CTGCACCCTGGTCTGAGTCAAAAGTGATGGTGCCAACCAAATTCATAGTTGGAGACCTAG
 
. : . : . : . : . : . :
rJMSF018L11+ ACTTAGTTTACCATATTCCAGGTGCAAAAGAATACATACACAATGGAGGGTTGAAGAATG
rJMSF020D10+ ACTTAGTTTATCAAATTCCAGGCGCAAAAGAATACATACACAATGGAGGGTTGAAGAATG
rJMFF051K22+ ACTTAGTTTACCATATTCCAGGTGCAAAAGAATACATACACAATGGAGGGTTGAAGAATG
                      ____________________________________________________________
consensus ACTTAGTTTACCATATTCCAGGTGCAAAAGAATACATACACAATGGAGGGTTGAAGAATG
 
. : . : . : . : . : . :
rJMSF018L11+ ATGTGCCACTGCTTGAAGATGTGGTGGTACTCCAAGGTGTGGCTCATTTCCTTAACCAAG
rJMSF020D10+ ATGTGCCATTACTGGAAGATGTGGTGGTACTCCAAGGTGTGGCTCATTTTCTCAACCAAG
rJMFF051K22+ ATGTGCCATTGCTGGAAGATGTGGTGGTTCTCAAAGGTGTGGCTCATTTCATCAATCAAG
                      ____________________________________________________________
consensus ATGTGCCATTGCTGGAAGATGTGGTGGTACTCCAAGGTGTGGCTCATTTCCTCAACCAAG
 
. : . : . : . : . : . :
rJMSF018L11+ AAGCACCTGAAGAGGTTAACAACCA
rJMSF020D10+ AAGCACCTCAAGAGGTTAACAACCA
rJMFF051K22+ AAGCGCCAGAAGAGGTTAACAACCATATCTTCCACTTTCTCAAGAAGTTCGTCTAAACTT
                      ____________________________________________________________
consensus AAGCACCTGAAGAGGTTAACAACCATATCTTCCACTTTCTCAAGAAGTTCGTCTAAACTT
 
. : . : . : . : . : . :
rJMFF051K22+ CCTTGTGAGGTTGGATTGTGTTTAGGATGAATAACAACCTTAATAGTGAAGCCAAGCGTT
                      ____________________________________________________________
consensus CCTTGTGAGGTTGGATTGTGTTTAGGATGAATAACAACCTTAATAGTGAAGCCAAGCGTT
 
. : . : . : . : . : . :
rJMFF051K22+ GCACTTTTAAGTTCTAAAAAACTGTATGTGTTTCTGAAAGTCTAAATGGAACAGGACTGG
                      ____________________________________________________________
consensus GCACTTTTAAGTTCTAAAAAACTGTATGTGTTTCTGAAAGTCTAAATGGAACAGGACTGG
 
. : . : . : . : . : . :
rJMFF051K22+ ATTTGATGATCTATATATGAAGTTTCTGATTXXXXXXXXXXXXXXXXXXCTCTCCAGGGT
                      ____________________________________________________________
consensus ATTTGATGATCTATATATGAAGTTTCTGATTNNNNNNNNNNNNNNNNNNCTCTCCAGGGT