Previous Contig 011101:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006P15Sequence495000910 (26)gb:AY091773_15747331e-27Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A763011101 (19)gb:ATARA12_15440731e-75A.thaliana mRNA for subtilisin-like protein.
JMFF009C21Sequence505000910 (26)gb:AY091773_15747332e-42Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A699011101 (19)gb:ATARA12_15440736e-67A.thaliana mRNA for subtilisin-like protein.
JMFF012K10Sequence530000910 (26)gb:AY091773_15747332e-52Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A735011101 (19)gb:ATARA12_15440732e-57A.thaliana mRNA for subtilisin-like protein.
JMFF016J02Sequence430000910 (26)gb:AY091773_15747338e-35Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A757011101 (19)gb:ATARA12_15440733e-78A.thaliana mRNA for subtilisin-like protein.
JMFF017L01Sequence574000910 (26)gb:AY091773_15747337e-13Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A600011101 (19)gb:ATARA12_15440731e-36A.thaliana mRNA for subtilisin-like protein.
JMFF018M07Sequence542000910 (26)gb:AY091773_15747335e-53Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A724011101 (19)gb:ATARA12_15440732e-56A.thaliana mRNA for subtilisin-like protein.
JMFF030P24Sequence471000910 (26)gb:AY091773_15747335e-43Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A633011101 (19)gb:ATARA12_15440733e-54A.thaliana mRNA for subtilisin-like protein.
JMFF035F02Sequence422000910 (26)gb:AY091773_15747332e-35Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A656011101 (19)pir|T07171|T071711e-42subtilisin-like proteinase (EC 3.4.21.-) 1 - tomato>gb:LES6378_1684621 Lycopersi
JMFF049C05Sequence462000910 (26)gb:AY091773_15747332e-37Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A323011101 (19)gb:AY091773_15747335e-11Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A
JMFF051K20Sequence596000910 (26)gb:AY091773_15747331e-31Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A518011101 (19)gb:PEU457185_16998934e-22Populus euramericana mRNA for putative serine protease (sp gene).
JMFS133A10Sequence631011101 (19)gb:ATARA12_15440738e-52A.thaliana mRNA for subtilisin-like protein.
JMSF001F03Sequence394000910 (26)gb:AY091773_15747333e-33Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A755011101 (19)gb:ATARA12_15440735e-80A.thaliana mRNA for subtilisin-like protein.
JMSF009M23Sequence283000910 (26)gb:AY091773_15747331e-16Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A730011101 (19)gb:ATARA12_15440735e-57A.thaliana mRNA for subtilisin-like protein.
JMSF011A15Sequence222000910 (26)gb:AY091773_15747336e-07Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A728011101 (19)gb:ATARA12_15440735e-57A.thaliana mRNA for subtilisin-like protein.
JMSF021M14Sequence657000910 (26)gb:AY091773_15747335e-71Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A749011101 (19)gb:ATARA12_15440732e-62A.thaliana mRNA for subtilisin-like protein.
JMSF025C05Sequence628000910 (26)gb:AY091773_15747333e-42Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A769011101 (19)gb:ATARA12_15440731e-81A.thaliana mRNA for subtilisin-like protein.
JMSF029E07Sequence676000910 (26)gb:AY091773_15747331e-73Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A732011101 (19)gb:ATARA12_15440736e-51A.thaliana mRNA for subtilisin-like protein.
JMSF031E12Sequence613000910 (26)gb:AY091773_15747335e-58Arabidopsis thaliana AT5g67360/K8K14_8 mRNA, complete cds.>gb:BT001082_1635337 A731011101 (19)gb:ATARA12_15440735e-57A.thaliana mRNA for subtilisin-like protein.
JMSF050J14Sequence644000282 (3)gb:AF139496_17714316e-84Prunus armeniaca p78RF mRNA, complete cds.185011101 (19)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001F03+ TCCGACGACCCTAGACGGGTAGCGTTCAACATCATA
rJMSF025C05+ CACCGGGTTATCCGACGACCCTAGACGGGTAGCGTTCAACATCATA
rJMFF016J02+ ACGGGTAGCGTTCAACATCATA
rJMFF006P15+ ACGGGTAGCGTTCAACATCATA
                      ____________________________________________________________
consensus CACCGGGTTATCCGACGACCCTAGACGGGTAGCGTTCAACATCATA
 
. : . : . : . : . : . :
rJMSF001F03+ TCTGGCACGTCAATGTCGTGTCCCCACGTGAGCGGCTTAGCCGCGCTGCTCAAAGGCGCG
rJMSF025C05+ TCTGGCACGTCAATGTCGTGTCCCCACGTGAGCGGCTTAGCCGCGCTGCTCAAAGGCGCG
rJMFF016J02+ TNTGGCACGTCAATGTCGTGTCCCCACGTGAGCGGCTTAGCCGCGCTGCTCAAAGGCGCG
rJMFF009C21+ CCGCGCTGCTCAAAGGCGCG
rJMFF006P15+ TCTGGCACGTCAATGTCGTGTCCCCACGTGAGCGGCTTAGCCGCGCTGCTCAAAGGCGCG
                      ____________________________________________________________
consensus TCTGGCACGTCAATGTCGTGTCCCCACGTGAGCGGCTTAGCCGCGCTGCTCAAAGGCGCG
 
. : . : . : . : . : . :
rJMSF001F03+ CACCCTGACTGGAGCCCAGCCGCCATCCGCTCAGCTCTCATGACCACCGCATA-CACGGC
rJMSF025C05+ CACCCTGACTGGAGCCCAGCCGCCATCCGCTCAGCTCTCATGACCACCGCATA-CACGGC
rJMFF016J02+ CACCCTGACTGGAGCCCAGCCGCCATCCGCTCAGCTCTCATGACCACCGCATA-CACGGC
rJMFF009C21+ CACCCTGACTGGAGCCCAGCCGCCATCCGCTCAGCTCTCATGACCACCGCATA-CACGGC
rJMFF006P15+ CACCCTGACTGGAGCCCAGCCGCCATCCGCTCAGCTCTCATGACCACCGCATACCACGGC
rJMSF021M14+ TGGAGCCCAGCCGCCATCCGCTCAGCTTTCATGACCACCGCATA-CACGGC
rJMSF031E12+ TCATGACCACCGCATA-CACGGC
rJMSF011A15+ TCATGACCACCGCATA-CACGGC
rJMSF009M23+ TCATGACCACCGCATA-CACGGC
rJMSF029E07+ TCTCATGACCACCGCATA-CACGGC
rJMFF018M07+ GACCACCGCATA-CACGGC
rJMFF030P24+ CGGC
rJMFF012K10+ AGCTNTCATGACCACCGCATA-CACGGC
                      ____________________________________________________________
consensus CACCCTGACTGGAGCCCAGCCGCCATCCGCTCAGCTCTCATGACCACCGCATA-CACGGC
 
. : . : . : . : . : . :
rJMSF001F03+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMSF025C05+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMFF016J02+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMFF009C21+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMFF006P15+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMSF021M14+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMSF031E12+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMSF011A15+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMSF009M23+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMSF029E07+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMFF018M07+ TTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
JMFS133A10- CACGGGAAAGCCATCCAACCCGTT
rJMFF030P24+ CCACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
rJMFF012K10+ CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
                      ____________________________________________________________
consensus CTACAAAAGCGGCGGCGGCGCGCTGGTCGACGTAGCCACGGGAAAGCCATCCAACCCGTT
 
. : . : . : . : . : . :
rJMSF001F03+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMSF025C05+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF016J02+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF009C21+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF006P15+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMSF021M14+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMSF031E12+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMSF011A15+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMSF009M23+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMSF029E07+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF018M07+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
JMFS133A10- CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF030P24+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF017L01+ TGGTTTAC
rJMFF012K10+ CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
rJMFF035F02+ TCACGGGTCGGGTCACGTCGACCCCGGGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
                      ____________________________________________________________
consensus CGATCACGGGTCGGGTCACGTCGACCC--GGTGTCGGCTCTCAGCCCGGGACTGGTTTAC
 
. : . : . : . : . : . :
rJMSF001F03+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMSF025C05+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMFF016J02+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMFF009C21+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMFF006P15+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMSF021M14+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMSF031E12+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMSF011A15+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMSF009M23+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMSF029E07+ GACATGAACGTCGTTGATTACCTGAATTTCCTCCTGTTCCTTGGGCTACACTCCATCGCA
rJMFF018M07+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
JMFS133A10- GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMFF030P24+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMFF017L01+ GACATGAACGTCGTTGATTACCTGAATTTCCT-NTGTTCCTTGGGCTNCACTCCATCGCA
rJMFF012K10+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
rJMFF035F02+ GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
                      ____________________________________________________________
consensus GACATGAACGTCGTTGATTACCTGAATTTCCT-CTGTTCCTTGGGCTACACTCCATCGCA
 
. : . : . : . : . : . :
rJMSF001F03+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMSF025C05+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF016J02+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF009C21+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF006P15+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMSF021M14+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMSF031E12+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMSF011A15+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMSF009M23+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMSF029E07+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF018M07+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
JMFS133A10- AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF030P24+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCGCCAAGAAATACAGCGTTAC
rJMFF017L01+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF012K10+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
rJMFF035F02+ AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
                      ____________________________________________________________
consensus AATCAACACTCTAGCGAGAAGGAATTTCACCTGCGATTCCACCAAGAAATACAGCGTTAC
 
. : . : . : . : . : . :
rJMSF001F03+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMSF025C05+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF016J02+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF009C21+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF006P15+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMSF021M14+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMSF031E12+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMSF011A15+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMSF009M23+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMSF029E07+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF018M07+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
JMFS133A10- AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF030P24+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF017L01+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF012K10+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF035F02+ AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
rJMFF051K20+ TCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
                      ____________________________________________________________
consensus AGACCTCAATTACCCTTCATTCGCCGTTTCATTCGCGTCGCAAATGGGCGGCGGCGGTTC
 
. : . : . : . : . : . :
rJMSF001F03+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMSF025C05+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF016J02+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF009C21+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF006P15+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMSF021M14+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMSF031E12+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMSF011A15+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMSF009M23+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMSF029E07+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF018M07+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
JMFS133A10- AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF030P24+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF017L01+ AAGTTCATCAGTTAAGTACACCAGAACCNTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF012K10+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF035F02+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
rJMFF051K20+ AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGAAACATACAA
                      ____________________________________________________________
consensus AAGTTCATCAGTTAAGTACACCAGAACCCTGACCAACGTGGGAGAAGCCGGAACATACAA
 
. : . : . : . : . : . :
rJMSF001F03+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMSF025C05+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF016J02+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF009C21+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF006P15+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMSF021M14+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMSF031E12+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMSF011A15+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMSF009M23+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMSF029E07+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF018M07+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
JMFS133A10- AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF030P24+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF017L01+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGNTAAG
rJMFF012K10+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF035F02+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
rJMFF049C05+ GACGGTAAG
rJMFF051K20+ AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
                      ____________________________________________________________
consensus AGTCTCCGTTAACGTACCAAACAGTTCCGTGAAAATCTTGGTTGAACCTCAGACGCTAAG
 
. : . : . : . : . : . :
rJMSF001F03+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF025C05+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF016J02+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF009C21+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF006P15+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF021M14+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF031E12+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF011A15+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF009M23+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF029E07+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF018M07+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMSF050J14+ CGTTCAGTGCTCCGGCAATGGC
JMFS133A10- TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF030P24+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF017L01+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF012K10+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF035F02+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF049C05+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
rJMFF051K20+ TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACTTTCAGTGCTCCGGCAATGGC
                      ____________________________________________________________
consensus TTTCAGGCAGACAAACGAGAAGAAATCGTACACCGTAACGTTCAGTGCTCCGGCAATGGC
 
. : . : . : . : . : . :
rJMSF001F03+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF025C05+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF016J02+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF009C21+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF006P15+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF021M14+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF031E12+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF011A15+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF009M23+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF029E07+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF018M07+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMSF050J14+ GGCCGACACAAACGTGTTNGGGAGAATCGAGNGGTCTGACGGGAAGCATNCAGNGGGAAG
JMFS133A10- GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF030P24+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF017L01+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGTTCTGACGGGAAGCATACAGTGGGAAG
rJMFF012K10+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF035F02+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF049C05+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
rJMFF051K20+ GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
                      ____________________________________________________________
consensus GGCCGACACAAACGTTTTCGGGAGAATCGAGTGGTCTGACGGGAAGCATACAGTGGGAAG
 
. : . : . : . : . : . :
rJMSF001F03+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF025C05+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF016J02+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF009C21+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF006P15+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF021M14+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF031E12+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF011A15+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF009M23+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF029E07+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF018M07+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMSF050J14+ TCCGGTGGCCATTTCTTGGNCGTAGAAAACNTAGGAANGAATATAATTAATGTATACTCT
JMFS133A10- TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF030P24+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF017L01+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF012K10+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF035F02+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF049C05+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
rJMFF051K20+ TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
                      ____________________________________________________________
consensus TCCGGTGGCCATTTCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCT
 
. : . : . : . : . : . :
rJMSF025C05+ CCTTAAT
rJMFF016J02+ CCTTAATTATTATTATTA-T
rJMFF009C21+ CCTTAATTATTATTATTA-TTA
rJMFF006P15+ CCTTAATTATTATTATTA-TTA
rJMSF021M14+ CCTTAATTATTATTATTA-TTATATAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMSF031E12+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMSF011A15+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMSF009M23+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMSF029E07+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMFF018M07+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMSF050J14+ CCTTAATTATTATNATTACATATGTAATAAATTTGCTAGCCTC
JMFS133A10- CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMFF030P24+ CCTTAATTATTGTTATTA-TTATGTAATAAATT
rJMFF017L01+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTTGCCCTGCTCTGCTG
rJMFF012K10+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMFF035F02+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMFF049C05+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
rJMFF051K20+ CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
                      ____________________________________________________________
consensus CCTTAATTATTATTATTA-TTATGTAATAAATTTGCTAGCCTCCTT-CCCTGCTCTGCTG
 
. : . : . : . : . : . :
rJMSF021M14+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTG
rJMSF031E12+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATT
rJMSF011A15+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACAT
rJMSF009M23+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACA
rJMSF029E07+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATT
rJMFF018M07+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACAT
JMFS133A10- TATTNTATTTGT
rJMFF017L01+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACA
rJMFF012K10+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATTA
rJMFF035F02+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATTATTTAACG
rJMFF049C05+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATTATTTAACG
rJMFF051K20+ TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATTATTTAACG
                      ____________________________________________________________
consensus TATTTTATTTGTTACTCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATTATTTAACG
 
. : . : . : . : . : . :
rJMFF035F02+ TT
rJMFF049C05+ TTGTAATTTATCGAAT
rJMFF051K20+ TTGTAATTTATCGAATTCTGCGCTGTTTGTTTCTCTACCAAATTTCAGTGTTTTCTTTGC
                      ____________________________________________________________
consensus TTGTAATTTATCGAATTCTGCGCTGTTTGTTTCTCTACCAAATTTCAGTGTTTTCTTTGC