Previous Contig 011092:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008A06Sequence484011092 (22)gb:AY048973_15617997e-06Solanum tuberosum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF010D20Sequence563011092 (22)gb:AB006696_15098124e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564726011092 (22)gb:AY048972_15617985e-05Nicotiana tabacum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF011D09Sequence534011092 (22)gb:AB006696_15098123e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564649011092 (22)gb:AY048973_15617993e-04Solanum tuberosum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF016L21Sequence571011092 (22)gb:AB006696_15098124e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564724011092 (22)gb:AY048972_15617985e-05Nicotiana tabacum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF026E06Sequence537011092 (22)gb:AB006696_15098123e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564663011092 (22)gb:AY048973_15617993e-04Solanum tuberosum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF026E21Sequence538011092 (22)gb:AB006696_15098123e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564111011092 (22)
JMFF026E22Sequence457011092 (22)gb:VCA429230_1727000e-123Volvox carteri f. nagariensis mRNA for pherophorin-dz1 protein.
JMFF035F12Sequence532011092 (22)gb:AB006696_15098123e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564746011092 (22)gb:AY048973_15617994e-04Solanum tuberosum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF045G15Sequence628011092 (22)gb:AB006696_15098125e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564426011092 (22)gb:AY048973_15617990.024Solanum tuberosum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMFF051I20Sequence550011092 (22)gb:AB006696_15098121e-34Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564530011092 (22)gb:AY048973_15617992e-04Solanum tuberosum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMSF008I09Sequence412011092 (22)gb:AB006696_15098127e-34Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564769011092 (22)gb:AY048972_15617981e-09Nicotiana tabacum RNA-binding protein precursor, mRNA, complete cds; nuclear gen
JMSF051P01Sequence704011092 (22)gb:AB006696_15098126e-35Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAF19.>gb:AY060565_1564743011092 (22)gb:AY048972_15617983e-05Nicotiana tabacum RNA-binding protein precursor, mRNA, complete cds; nuclear gen

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008I09- GCACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF051I20- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF045G15- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF026E21- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF016L21- ACTTGAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF026E22- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF010D20- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF035F12- CTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF026E06- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMFF011D09- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
JMSF051P01- ACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
                      ____________________________________________________________
consensus GCACTTAAACCTCCTTCGATCGAAAACCTCTCTACTAGGGTTTTACAGAAATCGTCTAA
 
. : . : . : . : . : . :
JMSF008I09- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF051I20- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF045G15- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF026E21- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF016L21- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF026E22- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF010D20- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF035F12- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF026E06- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMFF011D09- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
JMSF051P01- GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
                      ____________________________________________________________
consensus GAATGGCTTTCTTTAGTAAAGCTGGGAATGTACTCCGACAGGTGGTTAACAAGCCGCAAA
 
. : . : . : . : . : . :
JMSF008I09- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF051I20- TCAGCCATGGGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF045G15- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF026E21- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF016L21- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF026E22- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF010D20- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF035F12- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF026E06- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMFF011D09- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
JMSF051P01- TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
                      ____________________________________________________________
consensus TCAGCCATGAGATCTCTGCATCCACACCCTCAGTTTTCCAAATCCTGCGATTTATGTCAT
 
. : . : . : . : . : . :
JMSF008I09- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF051I20- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF045G15- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF026E21- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF016L21- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF026E22- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF010D20- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF035F12- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF026E06- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMFF011D09- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
JMSF051P01- CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
                      ____________________________________________________________
consensus CTTCAAAAGTTTTTGTAGGAGGAATCTCTTGGAGTACAAGTGATGCAAGTCTTCAAGATG
 
. : . : . : . : . : . :
JMSF008I09- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF051I20- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF045G15- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF026E21- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF016L21- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF026E22- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF010D20- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF035F12- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF026E06- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMFF011D09- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
JMSF051P01- CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
rJMSF008I09+ AGGCA
                      ____________________________________________________________
consensus CCTTCCGTAAATATGGAGATGTCATTGAAGCAAGGATTATTACAGATCGTGAGACAGGCA
 
. : . : . : . : . : . :
JMSF008I09- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF051I20- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF045G15- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF026E21- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF016L21- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF026E22- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGNCCTGAGGATGCTAGTGCGGCAATCC
JMFF010D20- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF035F12- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF026E06- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMFF011D09- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
JMSF051P01- GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
rJMFF016L21+ TGAGGATGCTAGTGCGGCAATCC
rJMFF010D20+ CTGAGGATGCTAGTGCGGCAATCC
rJMSF008I09+ GATCCAGGGGGNTTGGCTTTGTTACCTTNGNCAGTCCTGAGGATGCTAGTGCGGCAATCC
rJMSF051P01+ GGCAGTCCTGAGGATGCTAGTGCGGCAATCC
rJMFF035F12+ TAGTGCGGCAATCC
                      ____________________________________________________________
consensus GATCCAGGGGGTTTGGCTTTGTTACCTTTGGCAGTCCTGAGGATGCTAGTGCGGCAATCC
 
. : . : . : . : . : . :
JMSF008I09- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCA
JMFF051I20- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF045G15- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF026E21- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF016L21- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF026E22- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF010D20- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF035F12- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF026E06- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMFF011D09- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
JMSF051P01- AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
rJMFF016L21+ AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
rJMFF010D20+ AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
rJMSF008I09+ AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
rJMSF051P01+ AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
rJMFF035F12+ AGGCATTGGATGGCCAGATGCTTGATGNCCGCTCAATAAGGGTAANCTTTGCAAATGAAA
                      ____________________________________________________________
consensus AGGCATTGGATGGCCAGATGCTTGATGGCCGCTCAATAAGGGTAAACTTTGCAAATGAAA
 
. : . : . : . : . : . :
JMFF051I20- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
JMFF045G15- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
JMFF026E21- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGAGGGATATGGTGGTGGCAGATA
JMFF016L21- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGAGGGATATGGTGGTGGCAGATA
JMFF026E22- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGAGG
JMFF010D20- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
JMFF035F12- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
JMFF026E06- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
JMFF011D09- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGAGGGATATGGTGGTGGCAGATA
JMSF051P01- GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMFF016L21+ GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMFF010D20+ GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMSF008I09+ GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMSF051P01+ GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMFF035F12+ GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMFF011D09+ TGGTGGCGGA-GGATATGGTGGTGGCAGATA
rJMFF026E06+ GATGGTGGGTTCTGGTGGCGGAGGGATATGGTGGTGGCAGATA
                      ____________________________________________________________
consensus GGCCACCACGAAGCTTTGATGGTGGG-TCTGGTGGCGGA-GGATATGGTGGTGGCAGATA
 
. : . : . : . : . : . :
JMFF051I20- TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
JMFF045G15- TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
JMFF026E21- TGGAGGTGGCGGCGGCTATGG-ANGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
JMFF016L21- TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
JMFF010D20- TGGAGGTGGCGGCGGCTATGGAAGGTGGTGGTGGCTATGGGTGGTGGCAGTTATGGTAGT
JMFF035F12- TGGAGGTGGCGGCGGCTATGG-ANGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAG
JMFF026E06- TGGAGGTGGCGGCGGCTATGG-AAGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
JMFF011D09- TGGAGGTGGCGGCGGCTATGG-ANGTGGTGGTGGCTAT-GGTGGNGGCAGTTATGGTAGT
JMSF051P01- TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMFF016L21+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMFF010D20+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMSF008I09+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMSF051P01+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMFF035F12+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMFF011D09+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
rJMFF026E06+ TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
                      ____________________________________________________________
consensus TGGAGGTGGCGGCGGCTATGG-AGGTGGTGGTGGCTAT-GGTGGTGGCAGTTATGGTAGT
 
. : . : . : . : . : . :
JMFF051I20- GGTCAAGGTGGGTATGG
JMFF045G15- GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTC-AGGTGGCGAAGGTAGCTA
JMFF026E21- GGTC
JMFF016L21- GGTCAAGGTGGGTATGGTGGCAGTGGGGAATTTTGGT
JMFF010D20- GGTCAAGGTGGGTATGGTGGCAGT-GGGA
JMFF026E06- GGTC
JMSF051P01- GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMFF016L21+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMFF010D20+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMSF008I09+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMSF051P01+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMFF035F12+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMFF011D09+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
rJMFF026E06+ GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
                      ____________________________________________________________
consensus GGTCAAGGTGGGTATGGTGGCAGT-GGGAATTTTGGTGGTCAAGGTGGCGAAGGTAGCTA
 
. : . : . : . : . : . :
JMFF045G15- TGNGTGC-AATAATTATGGTAGTGGTGGCAGCGTGGGT
JMSF051P01- TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF016L21+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF010D20+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMSF008I09+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMSF051P01+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF035F12+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF011D09+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF026E06+ TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF008A06+ GTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
rJMFF051I20+ TAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
                      ____________________________________________________________
consensus TG-GTGCAAATAATTATGGTAGTGGTGGCAGCGTGGGTTATGGCGGTGACAACCAGAACT
 
. : . : . : . : . : . :
JMSF051P01- TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTA
rJMFF016L21+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF010D20+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMSF008I09+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMSF051P01+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF035F12+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF011D09+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF026E06+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF008A06+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF045G15+ TGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
rJMFF051I20+ TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
                      ____________________________________________________________
consensus TTGGTGCTGCTGGCGGGGACTTCCCCAGTGCTGGCAATACTTTTGCGAGTAGTGGGTTTG
 
. : . : . : . : . : . :
rJMFF016L21+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF010D20+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMSF008I09+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMSF051P01+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF035F12+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF011D09+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF026E06+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF008A06+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF045G15+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
rJMFF051I20+ AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
                      ____________________________________________________________
consensus AGGGAAATACAGGTTTTGGGTACGGCAGCAACAATCAATATGGAGACAATGCGAGCAGCA
 
. : . : . : . : . : . :
rJMFF016L21+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF010D20+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMSF008I09+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMSF051P01+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF035F12+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF011D09+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF026E06+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF008A06+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF045G15+ ACCCAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
rJMFF051I20+ ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
                      ____________________________________________________________
consensus ACACAGATGAAGCTGGGGGAGATGATAGCCATCCGGAACAGGGGAGCTTTAGAGACGACG
 
. : . : . : . : . : . :
rJMFF016L21+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF010D20+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMSF008I09+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMSF051P01+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF035F12+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF011D09+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF026E21+ TAGGATGATTTGATTGNTTGANAATATT
rJMFF026E06+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF008A06+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF045G15+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
rJMFF051I20+ ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
                      ____________________________________________________________
consensus ATGATCAACCCGATGACTATGCCAAACGAGCCTAGGATGATTTGATTGCTTGACAATATT
 
. : . : . : . : . : . :
rJMFF016L21+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMFF010D20+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMSF008I09+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMSF051P01+ TTGTGCTGCAGATGCAAAGATAATGGAACATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMFF035F12+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMFF011D09+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMFF026E21+ TTNTGCTGCAGATGCAAAGATGATGGAAGATGCCCTGTTCCNTATCCCTTNTTATTCAGA
rJMFF026E06+ TTGTGCTGCAGATGCAAAGATGATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMFF008A06+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
rJMFF045G15+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTTTTCAGA
rJMFF051I20+ TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
                      ____________________________________________________________
consensus TTGTGCTGCAGATGCAAAGATAATGGAAGATGCCCTCTTCCCTATCCCTTTTTCTTCAGA
 
. : . : . : . : . : . :
rJMFF016L21+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF010D20+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMSF008I09+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMSF051P01+ ACTGCCCTTGG-TTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF035F12+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF011D09+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTGATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF026E21+ ACTGCCCTTGGTTTTTTTT
rJMFF026E06+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF008A06+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF045G15+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
rJMFF051I20+ ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
                      ____________________________________________________________
consensus ACTGCCCTTGGTTTTTTTTTCTTCTTTTCTCATTGACTAAATTTGGCTATGTAAACTGTA
 
. : . : . : . : . : . :
rJMFF016L21+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAG
rJMFF010D20+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGA
rJMSF008I09+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATG
rJMSF051P01+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCT
rJMFF035F12+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
rJMFF011D09+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
rJMFF026E06+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
rJMFF008A06+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
rJMFF045G15+ TTTGAGGTTTTGAAACCCTCTTGTTTTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
rJMFF051I20+ TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
                      ____________________________________________________________
consensus TTTGAGGTTTTGAAACCCTCTTGTTCTAAACATCTGCCCAATTAAAGATGTATCTTGTTT
 
. : . : . : . : . : . :
rJMFF035F12+ AGAGTTATA
rJMFF011D09+ AGAGTTATA-GAAGA-TGAA
rJMFF026E06+ AGAGTTATA-GAAGA-TGAA
rJMFF008A06+ AGAGTTATATGAAGAT
rJMFF045G15+ AGAGTTATATGAAGATTGAAGATGCCTTTCAACT
rJMFF051I20+ AGAGTTATATGAAGATTGAAGATGCCTTTCAACTAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AGAGTTATATGAAGATTGAAGATGCCTTTCAACTAAAAAAAAAAAAAAACTCTCCAGGGT