Previous Contig 011091:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013O22Sequence568011091 (5)gb:AY156511_15853913e-43Oryza sativa (japonica cultivar-group) serine/threonine protein kinase (DPK2) mR758011091 (5)gb:AY156511_15853915e-43Oryza sativa (japonica cultivar-group) serine/threonine protein kinase (DPK2) mR
JMFF042C22Sequence628001641 (2)619011091 (5)gb:AY156511_15853915e-39Oryza sativa (japonica cultivar-group) serine/threonine protein kinase (DPK2) mR
JMFF051I12Sequence640011091 (5)gb:AY156511_15853914e-43Oryza sativa (japonica cultivar-group) serine/threonine protein kinase (DPK2) mR590011091 (5)gb:AY027437_15590417e-06Arachis hypogaea serine/threonine/tyrosine kinase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF013O22- TTTGGTGTTGTCCTGTGGGAGCTGA
rJMFF042C22+ TATAGCTTTGGTGTTGTCCTGTGGGAGCTGA
JMFF051I12- TTTGGTGTTGTCCTGTGGGAGCTGA
rJMFF013O22+ TTTGGTGTTGTCCTGTGGGAGCTGA
                      ____________________________________________________________
consensus TATAGCTTTGGTGTTGTCCTGTGGGAGCTGA
 
. : . : . : . : . : . :
JMFF013O22- TCACTGGGATGCTTCCCTTCCAGAACATGACTGCTGTGCAGGCGGCTTTTGCTGTTGTAA
rJMFF042C22+ TCACTGGGATGCTTCCCTTCCAGAACATGACTGCTGTGCAGGCGGCTTTTGCTGTTGTAA
JMFF051I12- TCACTGGGATGCTTCCCTTCCAGAACATGACTGCTGTGCAGGCGGCTTTTGCTGTTGTAA
rJMFF013O22+ TCACTGGGATGCTTCCCTTCCAGAACATGACTGCTGTGCAGGCGGCTTTTGCTGTTGTAA
                      ____________________________________________________________
consensus TCACTGGGATGCTTCCCTTCCAGAACATGACTGCTGTGCAGGCGGCTTTTGCTGTTGTAA
 
. : . : . : . : . : . :
JMFF013O22- ACAAAGGTGTCCGCCCGACAATACCGAACGATTGTTTGCCCGTCCTGGCTGAGATCATGA
rJMFF042C22+ ACAAAGGTGTCCGCCCGACAATACCGAACGATTGTTTGCCCGTCCTGGCTGAGATCATGA
JMFF051I12- ACAAAGGTGTCCGCCCGACAATACCGAACGATTGTTTGCCCGTCCTGGCTGAGATCATGA
rJMFF013O22+ ACAAAGGTGTCCGCCCGACAATACCGAACGATTGTTTGCCCGTCCTGGCTGAGATCATGA
                      ____________________________________________________________
consensus ACAAAGGTGTCCGCCCGACAATACCGAACGATTGTTTGCCCGTCCTGGCTGAGATCATGA
 
. : . : . : . : . : . :
JMFF013O22- GCCGCTGCTGGGATCCTAATCCTGATGTTAGGCCCCCCTTCTCCGAGGTGGTCAGAATGC
rJMFF042C22+ GCCGCTGCTGGGATCCTAATCCTGATGTTAGGCCCCCCTTCTCCGAGGTGGTCAGAATGC
JMFF051I12- GCCGCTGCTGGGATCCTAATCCTGATGTTAGGCCCCCCTTCTCCGAGGTGGTCAGAATGC
rJMFF013O22+ GCCGCTGCTGGGATCCTAATCCTGATGTTAGGCCCCCCTTCTCCGAGGTGGTCAGAATGC
                      ____________________________________________________________
consensus GCCGCTGCTGGGATCCTAATCCTGATGTTAGGCCCCCCTTCTCCGAGGTGGTCAGAATGC
 
. : . : . : . : . : . :
JMFF013O22- TGGAGGCTGCCGAAACAGAGATCATGACAACTGTGAGGAAGGCGCGTTTCAGATGCTGCA
rJMFF042C22+ TGGAGGCTGCCGAAACAGAGATCATGACAACTGTGAGGAAGGCGCGTTTCAGATGCTGCA
JMFF051I12- TGGAGGCTGCCGAAACAGAGATCATGACAACTGTGAGGAAGGCGCGTTTCAGATGCTGCA
rJMFF013O22+ TGGAGGCTGCCGAAACAGAGATCATGACAACTGTGAGGAAGGCGCGTTTCAGATGCTGCA
rJMFF051I12+ CGAAACAGAGATCATGACAACTGTGAGGAAGGCGCGTTTCAGATGCTGCA
                      ____________________________________________________________
consensus TGGAGGCTGCCGAAACAGAGATCATGACAACTGTGAGGAAGGCGCGTTTCAGATGCTGCA
 
. : . : . : . : . : . :
JMFF013O22- TGACCCAACCGATGACTATGGACTGATGAAGAACAGGAGAAATTAGAAGCAGAATGGAGA
rJMFF042C22+ TGACCCCACCGATGACTATGGACTGATGAAGAACAGGAGAAATTAGAAGCAGAATGGAGA
JMFF051I12- TGACCCAACCGATGACTATGGACTGATGAAGAACAGGAGAAATTAGAAGCAGAATGGAGA
rJMFF013O22+ TGACCCAACCGATGACTATGGACTGATGAAGAACAGGAGAAATTAGAAGCAGAATGGAGA
rJMFF051I12+ TGACCCAACCGATGACTATGGACTGATGAAGAACAGGAGAAATTAGAAGCAGAATGGAGA
                      ____________________________________________________________
consensus TGACCCAACCGATGACTATGGACTGATGAAGAACAGGAGAAATTAGAAGCAGAATGGAGA
 
. : . : . : . : . : . :
JMFF013O22- TAAAAGGCGGCGAGAGGAAAGCTGATTCTAAGTTGTGTATGCATTCGGGCATATCATTTC
rJMFF042C22+ TAAAAGGCGGCGAGAGGAAAGCTGATTCTAAGTTGTGTATGCATTCGGGCATATCATTTC
JMFF051I12- TAAAAGGCGGCGAGAGGAAAGCTGATTCTAAGTTGTGTATGCATTCGGGCATATCATTTC
rJMFF013O22+ TAAAAGGCGGCGAGAGGAAAGCTGATTCTAAGTTGTGTATGCATTCGGGCATATCATTTC
rJMFF051I12+ TAAAAGGCGGCGAGAGGAAAGCTGATTCTAAGTTGTGTATGCATTCGGGCATATCATTTC
                      ____________________________________________________________
consensus TAAAAGGCGGCGAGAGGAAAGCTGATTCTAAGTTGTGTATGCATTCGGGCATATCATTTC
 
. : . : . : . : . : . :
JMFF013O22- TTTATTCAGATAGAAGAAAGGGGAAGAAAGTTATGATGATGATAAGAACTGCTTGTTTTG
rJMFF042C22+ TTTATTCAGATAGAAGAAAGGGGAAGAAAGTTATGATGATGATAAGAACTGCTTGTTTTG
JMFF051I12- TTTATTCAGATAGAAGAAAGGGGAAGAAAGTTATGATGATGATAAGAACTGCTTGTTTTG
rJMFF013O22+ TTTATTCAGATAGAAGAAAGGGGAAGAAAGTTATGATGATGATAAGAACTGCTTGTTTTG
rJMFF051I12+ TTTATTCAGATAGAAGAAAGGGGAAGAAAGTTATGATGATGATAAGAACTGCTTGTTTTG
                      ____________________________________________________________
consensus TTTATTCAGATAGAAGAAAGGGGAAGAAAGTTATGATGATGATAAGAACTGCTTGTTTTG
 
. : . : . : . : . : . :
JMFF013O22- TGTTTCGTTTTGATGGATTTAAGAACAATGCTGATTAGTGGTAATAGGGAGGCTTGATAT
rJMFF042C22+ TGTTTCGTTTTGATGGATTTAAGAACAATGCTGATTAGTGGTAATAGGGAGGCTTGATAT
JMFF051I12- TGTTTCGTTTTGATGGATTTAAGAACAATGCTGATTAGTGGTAATAGGGAGGCTTGATAT
rJMFF013O22+ TGTTTCGTTTTGATGGATTTAAGAACAATGCTGATTAGTGGTAATAGGGAGGCTTGATAT
rJMFF051I12+ TGTTTCGTTTTGATGGATTTAAGAACAATGCTGATTAGTGGTAATAGGGAGGCTTGATAT
                      ____________________________________________________________
consensus TGTTTCGTTTTGATGGATTTAAGAACAATGCTGATTAGTGGTAATAGGGAGGCTTGATAT
 
. : . : . : . : . : . :
JMFF013O22- GTATCTATACATGTCCTTTGTTGATGTGATTAAACCTGCTCTGTTTAGTTGTTTGACTTT
rJMFF042C22+ GTATCTATACATGTCCTTTGTTGATGTGATTAAACCTGCTCTGTTTAGTTGTTTGACTTT
JMFF051I12- GTATCTATACATGTCCTTTGTTGATGTGATTAAACCTGCTCTGTTTAGTTGTTTGACTTT
rJMFF013O22+ GTATCTATACATGTCCTTTGTTGATGTGATTAAACCTGCTCTGTTTAGTTGTTTGACTTT
rJMFF051I12+ GTATCTATACATGTCCTTTGTTGATGTGATTAAACCTGCTCTGTTTAGTTGTTTGACTTT
                      ____________________________________________________________
consensus GTATCTATACATGTCCTTTGTTGATGTGATTAAACCTGCTCTGTTTAGTTGTTTGACTTT
 
. : . : . : . : . : . :
JMFF013O22- CA
rJMFF042C22+ CATCAGAATCTGAATATAGCAGGGCTTGAAGGTCCTTGCATAATGC
JMFF051I12- CATCAGAATCTGAATATAGCAGGGCTTGAAGGTCCTTGCATAATGCTCACCTGCCATCTT
rJMFF013O22+ CATCAGAATCTGAATATAGCAGGGCTTGAAGGTCCTTGCATAATGCTCACCTGCCATCTT
rJMFF051I12+ CATCAGAATCTGAATATAGCAGGGCTTGAAGGTCCTTGCATAATGCTCACCTGCCATCTT
                      ____________________________________________________________
consensus CATCAGAATCTGAATATAGCAGGGCTTGAAGGTCCTTGCATAATGCTCACCTGCCATCTT
 
. : . : . : . : . : . :
JMFF051I12- TACTTTTACCTCAT
rJMFF013O22+ TACTTTTACCTCATCTCCCAGTATTCCTGTCCTGTCCTTCATTTTACCCTGAAATGCACT
rJMFF051I12+ TACTTTTACCTCATCTCCCAGTATTCCTGTCCTGTCCTTCATTTTACCCTGAAATGCACT
                      ____________________________________________________________
consensus TACTTTTACCTCATCTCCCAGTATTCCTGTCCTGTCCTTCATTTTACCCTGAAATGCACT
 
. : . : . : . : . : . :
rJMFF013O22+ CAACTCCTTCTAGTCAACTCCTTCTAGTCTTCCATTGTTTTACCACAAAAACACTTTTGT
rJMFF051I12+ CAACTCCTTCTAGTCAACTCCTTCTAGTCTTCCATTGTTTTACCACAAAAACACTTTTGT
                      ____________________________________________________________
consensus CAACTCCTTCTAGTCAACTCCTTCTAGTCTTCCATTGTTTTACCACAAAAACACTTTTGT
 
. : . : . : . : . : . :
rJMFF013O22+ ATACGAAATCAT
rJMFF051I12+ ATACGAAATCATAGTTATTTCTTATGATXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGT
                      ____________________________________________________________
consensus ATACGAAATCATAGTTATTTCTTATGATNNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGT