Previous Contig 011082:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017I09Sequence556007691 (6)pir|T06824|T068242e-68translation initiation factor - garden pea>gb:PSY17186_1702598 Pisum sativum mRN811011082 (3)sp|P41380|IF43_NICPL2e-93Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).>pir|S22579|S22579 transl
JMFF025L23Sequence627007691 (6)sp|P41380|IF43_NICPL1e-63Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).>pir|S22579|S22579 transl813011082 (3)sp|P41380|IF43_NICPL9e-92Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).>pir|S22579|S22579 transl
JMFF051G16Sequence619007691 (6)pir|T06824|T068244e-72translation initiation factor - garden pea>gb:PSY17186_1702598 Pisum sativum mRN554011082 (3)sp|P41380|IF43_NICPL2e-39Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).>pir|S22579|S22579 transl

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017I09+ TAGTAAAACGTGATGAGTTGACCCTAGAGGGCATCAAACAGTTCTTTG
rJMFF025L23+ CNTAGTAAANCGTGATGAGTTGACCCTAGAGGGCATCAANCAGTTCTTTG
                      ____________________________________________________________
consensus CNTAGTAAAACGTGATGAGTTGACCCTAGAGGGCATCAAACAGTTCTTTG
 
. : . : . : . : . : . :
rJMFF017I09+ TTGCTGTGGAGAAAGAGGAGTGGAAATTCGACACACTTTGTGATCTTTATGATACCCTGA
rJMFF025L23+ TTGCTGTGGAGAAAGAGGAGTGGAAATTCGACACACTTTGTGATCTTTATGATACCCTGA
                      ____________________________________________________________
consensus TTGCTGTGGAGAAAGAGGAGTGGAAATTCGACACACTTTGTGATCTTTATGATACCCTGA
 
. : . : . : . : . : . :
rJMFF017I09+ CCATCACCCAAGCTGTTATTTTTTGCAATACAAAGCGGAAGGTGGACTGGTTGACTAGCA
rJMFF025L23+ CCATCACCCAAGCTGTTATTTTTTGCAATACAAAGCGGAAGGTGGACTGGTTGACTAGCA
                      ____________________________________________________________
consensus CCATCACCCAAGCTGTTATTTTTTGCAATACAAAGCGGAAGGTGGACTGGTTGACTAGCA
 
. : . : . : . : . : . :
rJMFF017I09+ AGATGCGTGAAAATAACTTCACAGTCTCATCCATGCACGGGGATATGCCACAAAAGGAGC
rJMFF025L23+ AGATGCGTGAAAATAACTTCACAGTCTCATCCATGCACGGGGATATGCCACAAAAGGAGC
                      ____________________________________________________________
consensus AGATGCGTGAAAATAACTTCACAGTCTCATCCATGCACGGGGATATGCCACAAAAGGAGC
 
. : . : . : . : . : . :
rJMFF017I09+ GAGATGCTATAATGGGAGAGTTCCGGTCTGGCACAACTCGTGTCCTCATTACAACAGATG
rJMFF025L23+ GAGATGCTATAATGGGAGAGTTCCGGTCTGGCACAACTCGTGTCCTCATTACAACAGATG
rJMFF051G16+ CATTACAACAGATG
                      ____________________________________________________________
consensus GAGATGCTATAATGGGAGAGTTCCGGTCTGGCACAACTCGTGTCCTCATTACAACAGATG
 
. : . : . : . : . : . :
rJMFF017I09+ TTTGGGCTAGAGGGCTGGATGTTCAACAGGTTTCCCTGGTTATTAACTATGACCTTCCAA
rJMFF025L23+ TTTGGGCTAGAGGGCTGGATGTTCAACAGGTTTCCCTGGTTATTAACTATGACCTTCCAA
rJMFF051G16+ TTTGGGCTAGAGGGCTGGATGTTCAACAGGTTTCCCTGGTTATTAACTATGACCTTCCAA
                      ____________________________________________________________
consensus TTTGGGCTAGAGGGCTGGATGTTCAACAGGTTTCCCTGGTTATTAACTATGACCTTCCAA
 
. : . : . : . : . : . :
rJMFF017I09+ ACAATCGAGAACTCTACATTCATCGCATTGGTCGTTCTGGTCGTTTTGGGCGGAAGGGTG
rJMFF025L23+ ACAATCGAGAACTCTACATTCATCGCATTGGTCGTTCTGGTCGTTTTGGGCGGAAGGGTG
rJMFF051G16+ ACAATCGAGAACTCTACATTCATCGCATTGGTCGTTCTGGTCGTTTTGGGCGGAAGGGTG
                      ____________________________________________________________
consensus ACAATCGAGAACTCTACATTCATCGCATTGGTCGTTCTGGTCGTTTTGGGCGGAAGGGTG
 
. : . : . : . : . : . :
rJMFF017I09+ TTGCGATAAATTTTGTTAAAAGTGATGATATCAAAATTCTGAGGGACATAGAGCAATACT
rJMFF025L23+ TTGCGATAAATTTTGTTAAAAGTGATGATATCAAAATTCTGAGGGACATAGAGCAATACT
rJMFF051G16+ TTGCGATAAATTTTGTTAAAAGTGATGATATCAAAATTCTGAGGGACATAGAGCAATACT
                      ____________________________________________________________
consensus TTGCGATAAATTTTGTTAAAAGTGATGATATCAAAATTCTGAGGGACATAGAGCAATACT
 
. : . : . : . : . : . :
rJMFF017I09+ ATAGTACCCAGATTGATGAAATGCCAATGAATGTTGCGGATTTGTTATGATGGGCCTTTG
rJMFF025L23+ ATAGTACCCAGATTGATGAAATGCCAATGAATGTTGCGGATTTGATATGATGGGCCTTTG
rJMFF051G16+ ATAGTACCCAGATTGATGAAATGCCAATGAATGTTGCGGATTTGATATGATGGGCCTTTG
                      ____________________________________________________________
consensus ATAGTACCCAGATTGATGAAATGCCAATGAATGTTGCGGATTTGATATGATGGGCCTTTG
 
. : . : . : . : . : . :
rJMFF017I09+ CCAAGGGACGATCTTCTACTTCTACTCTGCAAAGCAATGGTGTCAACATTTTGCAATGGG
rJMFF025L23+ CCAAGGGACGATCTTCTACTTCTACTCTGCAAAGCAATGGTGTCAACATTTTGCAATGGG
rJMFF051G16+ CCAAGGGACGATCTTCTACTTCTACTCTGCAAAGCAATGGTGTCAACATTTTGCAATGGG
                      ____________________________________________________________
consensus CCAAGGGACGATCTTCTACTTCTACTCTGCAAAGCAATGGTGTCAACATTTTGCAATGGG
 
. : . : . : . : . : . :
rJMFF017I09+ CTTGACTTGTGTGATGGGTTTGTACTACGGGTGCATTGTCCTTGTCAAGTTTTAAAACCA
rJMFF025L23+ CTTGACTTGTGTGATGGGTTTGTACTACGGGTGCATTGTCCTTGTCAAGTTTTAAAACCA
rJMFF051G16+ CTTGACTTGTGTGATGGGTTTGTACTACGGGTGCATTGTCCTTGTCAAGTTTTAAAACCA
                      ____________________________________________________________
consensus CTTGACTTGTGTGATGGGTTTGTACTACGGGTGCATTGTCCTTGTCAAGTTTTAAAACCA
 
. : . : . : . : . : . :
rJMFF017I09+ CTTTGTAATCAGATTTGCCTGTCTGGAATGGATTGGTTTGGGATCTGGATTTTGACACTA
rJMFF025L23+ CTTTGTAATCAGATTTGCCTGTCTGGAATGGATTGGTTTGGGATCTGGATTTTGACACTA
rJMFF051G16+ CTTTGTAATCAGATTTGCCTGTCTGGAATGGATTGGTTTGGGATCTGGATTTTGACACTA
                      ____________________________________________________________
consensus CTTTGTAATCAGATTTGCCTGTCTGGAATGGATTGGTTTGGGATCTGGATTTTGACACTA
 
. : . : . : . : . : . :
rJMFF017I09+ TAATTTCAGTAATTGTGTGTATACTAATTGTGATCACCTTTTAGCATTAGGATTGATTAT
rJMFF025L23+ TAATTTCAGTAATTGTGTGTATACTAATTGTGATCACCTTTTAGCATTAGGATTGATTAT
rJMFF051G16+ TAATTTCAGTAATTGTGTGTATACTAATTGTGATCACCTTTTAGCATTAGGATTGATTAT
                      ____________________________________________________________
consensus TAATTTCAGTAATTGTGTGTATACTAATTGTGATCACCTTTTAGCATTAGGATTGATTAT
 
. : . : . : . : . : . :
rJMFF017I09+ CATGAGTATGTTCAGACGTTTATAACTTATTTT
rJMFF025L23+ CATGAGTATGTTCAGACGTTTATAACTTATTTTTA
rJMFF051G16+ CATGAGTATGTTCAGACGTTTATAACTTATTTTTATGAACAAACGCTTGTGCTTCTCCCT
                      ____________________________________________________________
consensus CATGAGTATGTTCAGACGTTTATAACTTATTTTTATGAACAAACGCTTGTGCTTCTCCCT