Previous Contig 011077:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020F04Sequence588001022 (2)gb:AC068197_15403531e-06Genomic sequence for Arabidopsis thaliana BAC F16A14 from chromosome I, complete636011077 (2)
JMFF051F20Sequence565001022 (2)547011077 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020F04+ CTACAGTTGATTCACAGGAATACGATGGAGGTAACCGTTTCATTGATACTGGAGTTG
                      ____________________________________________________________
consensus CTACAGTTGATTCACAGGAATACGATGGAGGTAACCGTTTCATTGATACTGGAGTTG
 
. : . : . : . : . : . :
rJMFF020F04+ ATAGCAAGTTTTCAACTGGTCTCGAAAAAGAGTTTGTTCTATCGCCACATGAGCAAAGTG
                      ____________________________________________________________
consensus ATAGCAAGTTTTCAACTGGTCTCGAAAAAGAGTTTGTTCTATCGCCACATGAGCAAAGTG
 
. : . : . : . : . : . :
rJMFF020F04+ ATACGATTGAAGCTGCAACACAGAGAGATTTGGAAGCACCCGTTAGCCCCGAGAACAAAG
                      ____________________________________________________________
consensus ATACGATTGAAGCTGCAACACAGAGAGATTTGGAAGCACCCGTTAGCCCCGAGAACAAAG
 
. : . : . : . : . : . :
rJMFF020F04+ AGTGCGCTCCACCGAGAGGGGATTCTCAGGATAACCAACTCGAAAGATGTACTAGCTCAT
rJMFF051F20+ AGCTCAT
                      ____________________________________________________________
consensus AGTGCGCTCCACCGAGAGGGGATTCTCAGGATAACCAACTCGAAAGATGTACTAGCTCAT
 
. : . : . : . : . : . :
rJMFF020F04+ TGAAACTAGAAGGCGAGATCCAAGAAGAGGAAGAGGACAGGGTTGCAGCAGACACGTTGT
rJMFF051F20+ TGAAACTAGAAGGCGAGATCCAAGAAGAGGAAGAGGACAGGGTTGCAGCAGACACGTTGT
                      ____________________________________________________________
consensus TGAAACTAGAAGGCGAGATCCAAGAAGAGGAAGAGGACAGGGTTGCAGCAGACACGTTGT
 
. : . : . : . : . : . :
rJMFF020F04+ TTGTTCTTTCGTCATCAAAGACCACATTCATCGACCAAAATGAAGCCTTTAATGACTGCC
rJMFF051F20+ TTGTTCTTTCGTCATCAAAGACCACATTCATCGACCAAAATGAAGCCTTTAATGACTGCC
                      ____________________________________________________________
consensus TTGTTCTTTCGTCATCAAAGACCACATTCATCGACCAAAATGAAGCCTTTAATGACTGCC
 
. : . : . : . : . : . :
rJMFF020F04+ TAGATTGGTTTGCTGGAATCGCATCCTCTTTGGCGAATAATCAACAGACATATGCTAAAG
rJMFF051F20+ TAGATTGGTTTGCTGGAATCGCATCCTCTTTGGCGAATAATCAACAGACATATGCTAAAG
                      ____________________________________________________________
consensus TAGATTGGTTTGCTGGAATCGCATCCTCTTTGGCGAATAATCAACAGACATATGCTAAAG
 
. : . : . : . : . : . :
rJMFF020F04+ AGATGGAAATAGTCGACGCCTCATTACCTAGCCGGCTAAAGAGGGGACAGAAAAAGATGA
rJMFF051F20+ AGATGGAAATAGTCGACGCCTCATTACCTAGCCGGCTAAAGAGGGGACAGAAAAAGATGA
                      ____________________________________________________________
consensus AGATGGAAATAGTCGACGCCTCATTACCTAGCCGGCTAAAGAGGGGACAGAAAAAGATGA
 
. : . : . : . : . : . :
rJMFF020F04+ AATTGCAGGTGAACAACTTTCAGAAAGAAGTAAACGAGGCGCCAGTGGAAACCGCCACTT
rJMFF051F20+ AATTGCAGGTGAACAACTTTCAGAAAGAAGTAAACGAGGCGCCAGTGGAAACCGCCACTT
                      ____________________________________________________________
consensus AATTGCAGGTGAACAACTTTCAGAAAGAAGTAAACGAGGCGCCAGTGGAAACCGCCACTT
 
. : . : . : . : . : . :
rJMFF020F04+ CTGCAAGGAGAAGCGTTAGTAGAGGCAGTGGCGGGAGAGGGAGGAGACAACCCAAAGCGT
rJMFF051F20+ CTGCAAGGAGAAGCGTTAGTAGAGGCAGTGGCGGGAGAGGGAGGAGACAACCCAAAGCGT
                      ____________________________________________________________
consensus CTGCAAGGAGAAGCGTTAGTAGAGGCAGTGGCGGGAGAGGGAGGAGACAACCCAAAGCGT
 
. : . : . : . : . : . :
rJMFF020F04+ CGGAGATGACAGTGCCAGTTTGGGGGAAGANTAAAAGGC
rJMFF051F20+ CGGAGATGACAGTGCCAGTTTGGGGGAAGACTAAAAGGCGCCAAATGGCTCGTGTTGCTC
                      ____________________________________________________________
consensus CGGAGATGACAGTGCCAGTTTGGGGGAAGACTAAAAGGCGCCAAATGGCTCGTGTTGCTC
 
. : . : . : . : . : . :
rJMFF051F20+ GATCCATTAACCATTCTCCTCTTTAGCTCATTTCATTGCTACTTTAACTAGATGTCTTTC
                      ____________________________________________________________
consensus GATCCATTAACCATTCTCCTCTTTAGCTCATTTCATTGCTACTTTAACTAGATGTCTTTC
 
. : . : . : . : . : . :
rJMFF051F20+ TCTCTCTCTCTCTCTGTATAAACAGTACAGTXXXXXXXXXXXXXXXXXXCTCTCCAGGGT
                      ____________________________________________________________
consensus TCTCTCTCTCTCTCTGTATAAACAGTACAGTNNNNNNNNNNNNNNNNNNCTCTCCAGGGT