Previous Contig 011068:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005A05Sequence492014131gb:AB024033_15157883e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AY045904_156693011068 (6)pir|G96584|G965841e-77hypothetical protein F20D21.14 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMFF005M24Sequence130000016 (73)529011068 (6)pir|G96584|G965845e-60hypothetical protein F20D21.14 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMFF012P19Sequence495000687 (4)pir|T50526|T505262e-10CaLB protein - Arabidopsis thaliana>gb:ATT27I15_1555539 Arabidopsis thaliana DNA745011068 (6)gb:AP005772_18575952e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFF019B22Sequence529000687 (4)pir|G96584|G965849e-25hypothetical protein F20D21.14 [imported] - Arabidopsis thaliana>gb:AE005173_893686011068 (6)pir|G96584|G965841e-70hypothetical protein F20D21.14 [imported] - Arabidopsis thaliana>gb:AE005173_893
JMFF020B14Sequence629000687 (4)gb:AB024033_15157882e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AY045904_156444011068 (6)gb:AK175330_18173184e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-77-H08.
JMFF051E16Sequence616000687 (4)gb:AB024033_15157882e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.>gb:AY045904_156525011068 (6)pir|G96584|G965842e-45hypothetical protein F20D21.14 [imported] - Arabidopsis thaliana>gb:AE005173_893

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020B14+ GCCTGAAGAT
rJMFF012P19+ GCCTGAAGAT
                      ____________________________________________________________
consensus GCCTGAAGAT
 
. : . : . : . : . : . :
rJMFF019B22+ TTTGTTTAATGA
rJMFF005A05+ TTTGTTTAATGA
rJMFF020B14+ AAAGTCAATGGGACTGTCATAGTT-CCCTGTGGCCTTATAGCCTGGAGTTTGTTTAATGA
rJMFF012P19+ AAAGTCAATGGGACTGTCATAGTTCCCCTGTGGCCTTATAGCCTGGAGTTTGTTTAATGA
                      ____________________________________________________________
consensus AAAGTCAATGGGACTGTCATAGTTCCCCTGTGGCCTTATAGCCTGGAGTTTGTTTAATGA
 
. : . : . : . : . : . :
rJMFF019B22+ TACNTACAGCTTTCCCCGCACCAATGTACAGCTGNCTGTAAACCAAANTAGAATATCATG
rJMFF005A05+ TACCTACAGCTTTACCCGCAACAATGTACAGCTGACTGTAAACCAAACTAGAATATCATG
rJMFF020B14+ TACCTACAGCTTTACCCGCAACAATGTACAGCTGACTGTAAACCAAACTAGAATATCATG
rJMFF012P19+ TACCTACAGCTTTACCCGCAACAATGTACAGCTGACTGTAAACCAAACTAGAATATCATG
                      ____________________________________________________________
consensus TACCTACAGCTTTACCCGCAACAATGTACAGCTGACTGTAAACCAAACTAGAATATCATG
 
. : . : . : . : . : . :
rJMFF019B22+ GAAGAGTGACAGGGATCACAAGTTTGGCAAAGACGTCTATCCAAAGAACTTTCAGAATGG
rJMFF005M24+ GTCTATCCAAAGAACTTTCAGAATGG
rJMFF005A05+ GAAGAGTGACAGGGATCACAAGTTTGGCAAAGACGTCTATCCAAAGAACTTTCAGAATGG
rJMFF020B14+ GAAGAGTGACAGGGATCACAAGTTTGGCAAAGACGTCTATCCAAAGAACTTTCAGAATGG
rJMFF012P19+ GAAGAGTGACAGGGATCACAAGTTTGGCAAAGACGTCTATCCAAAGAACTTTCAGAATGG
                      ____________________________________________________________
consensus GAAGAGTGACAGGGATCACAAGTTTGGCAAAGACGTCTATCCAAAGAACTTTCAGAATGG
 
. : . : . : . : . : . :
rJMFF019B22+ GTCTCTGATTGGGGGTAAGAAGCTTGACCCAGAGAAGCCGTTGAGTGAGCAGGAGGACCT
rJMFF005M24+ GTCTCTGATTGGGGGTAAGAAGCTTGNCCCAGAGAAGCCGTTGAGTGAGCAGGAGGACCT
rJMFF005A05+ GTCTCTGATTGGGGGTAAGAAGCTTGACCCAGAGAAGCCGTTGAGTGAGCAAGAGGACCT
rJMFF020B14+ GTCTCTGATTGGGGGTAAGAAGCTTGACCCAGAGAAGCCGTTGAGTGAGCAGGAGGACCT
rJMFF012P19+ GTCTCTGATTGGGGGTAAGAAGCTTGACCCAGAGAAGCCGTTGAGTGAGCAGGAGGACCT
                      ____________________________________________________________
consensus GTCTCTGATTGGGGGTAAGAAGCTTGACCCAGAGAAGCCGTTGAGTGAGCAGGAGGACCT
 
. : . : . : . : . : . :
rJMFF019B22+ TATTGTTTGGATGCGANCTGCTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
rJMFF005M24+ TATTGTTTGGATGCGAACTGNTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
rJMFF005A05+ TATTGTTTGGATGCGAACTGCTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
rJMFF020B14+ TATTGTTTGGATGCGAACTGCTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
rJMFF012P19+ TATTGTTTGGATGCGAACTGCTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
rJMFF051E16+ AACTGCTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
                      ____________________________________________________________
consensus TATTGTTTGGATGCGAACTGCTGCTCTTCCAACGTTTAGGAAGTTATATGGGAAGATAGA
 
. : . : . : . : . : . :
rJMFF019B22+ GGTGGATCTTAATGCGAATGATGTCATTGATGTCNCGGTCGAGAATAATTACAATACCTA
rJMFF005M24+ GGTGGATCTTAATGCGAATGATGTCATTGATGTCACGGTCGAGAATAATTACAATACCTA
rJMFF005A05+ GGTGGATCTTAATGCGAATGATGTCATTGATGTCACGGTCGAGAATAATTACAATACCTA
rJMFF020B14+ GGTGGATCTTAATGCGAATGATGTCATTGATGTCACGGTCGAGAATAATTACAATACCTA
rJMFF012P19+ GGTGGATCTTAATGCGAATGATGTCATTGTTGTCACGGTCGAGAATAATTACAATACCTA
rJMFF051E16+ GGTGGATCTTAATGCGAATGATGTCATTGATGTCACGGTCGAGAATAATTACAATACCTA
                      ____________________________________________________________
consensus GGTGGATCTTAATGCGAATGATGTCATTGATGTCACGGTCGAGAATAATTACAATACCTA
 
. : . : . : . : . : . :
rJMFF019B22+ CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTCNCTGGGTGGAAAAAA
rJMFF005M24+ CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTGGCTGGGTGGAAAAAA
rJMFF005A05+ CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTGGCTGGGTGGAAAAAA
rJMFF020B14+ CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTGGCTGGGTGGAAAAAA
rJMFF012P19+ CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTGGCTGGGTGGAAAAAA
rJMFF051E16+ CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTGGCTGGGTGGAAAAAA
                      ____________________________________________________________
consensus CAGTTTCAATGGCAAGAAGAAACTTGTGCTTTCTACCACTAGCTGGCTGGGTGGAAAAAA
 
. : . : . : . : . : . :
rJMFF019B22+ TGATTTCNTGGNTATTGCATACCTTACTGTTGGTGGCTTGTGCTTCTTTTTGGCTATGGT
rJMFF005M24+ TGATTTCCTGGGTATTGCATACCTTACTGTTGGTGGCTTGTGCTTCTTTTTGGCTATGGT
rJMFF005A05+ TGATTTCCTGGGTATTGCATACCTTACTGTTGGTGGCTTGTGCTTCTTTTTGGCTATGGT
rJMFF020B14+ TGATTTCCTGGGTAT
rJMFF012P19+ TGATTTCCTGGGTATTGCATACCTTACTGTTGGTGGCTTGTGCTTCTTTTTGGCTATGGT
rJMFF051E16+ TGATTTCCTGGGTATTGCATACCTTACTGTTGGTGGCTTGTGCTTCTTTTTGGCTATGGT
                      ____________________________________________________________
consensus TGATTTCCTGGGTATTGCATACCTTACTGTTGGTGGCTTGTGCTTCTTTTTGGCTATGGT
 
. : . : . : . : . : . :
rJMFF019B22+ TTTCACTTTGATATATCTAGTTAAGCCAAGGCAACTTGGTGATCCATCTTATTTGTCATG
rJMFF005M24+ TTTCACTTTGATATATCTAGTTAAGCCAAGGCAACTTGGTGATCCATCTTATTTGTCATG
rJMFF005A05+ TTTCACTTTGATATATCTAGTTAAGCCAAGGCAACTTGGTGATCCATCTTATTTGTCATG
rJMFF012P19+ TTTCACTTTGATATATCTAGTTAAGCCAAGGCAACTTGGTGATCCATCTTATTTGTCATG
rJMFF051E16+ TTTCACTTTGATATATCTAGTTAAGCCAAGGCAACTTGGTGATCCATCTTATTTGTCATG
                      ____________________________________________________________
consensus TTTCACTTTGATATATCTAGTTAAGCCAAGGCAACTTGGTGATCCATCTTATTTGTCATG
 
. : . : . : . : . : . :
rJMFF019B22+ GANCCGGAATCCAGGCGGTCACTAGCAGGCTCATAAGGTGTGCATTGCCTTGAGCTATCT
rJMFF005M24+ GAACCGGAATCCAGGCGGTCACTAGCAGGCTCATAAGGTGTGCATTGCCTTGAGCTATCT
rJMFF005A05+ GAACCGGAATCCAGGCGGTCACTAGCAGGCTCATAAGGTGTGCATTGCCTTGAGCTATCT
rJMFF012P19+ GAACCGGAATCCAGGCGGTCACTAGCAGGCTCATAAGGTGTGCATTGCCTTGAGCTATCT
rJMFF051E16+ GAACCGGAATCCAGGCGGTCACTAGCAGGCTCATAAGGTGTGCATTGCCTTGAGCTATCT
                      ____________________________________________________________
consensus GAACCGGAATCCAGGCGGTCACTAGCAGGCTCATAAGGTGTGCATTGCCTTGAGCTATCT
 
. : . : . : . : . : . :
rJMFF019B22+ GTGATTGATTAAAGAGATGGAAGCTTGTCTTGATATTTTGGAACCAGCTATGTACAAAGT
rJMFF005M24+ GTGATTGATTAAAGAGATGGAAGCTTGTCTTGATATTTTGGAACCAGCTATGTACAAAGT
rJMFF005A05+ GTGATTGATTAAAGAGATGGAAGCTTGTCTTGATATTTTGGAACCAGCTATGTACAAAGT
rJMFF012P19+ GTGATTGATTAAAGAGATGGAAGCTTGTCTTGATATTTTGGAACCAGCTATGTACAAAGT
rJMFF051E16+ GTGATTGATTAAAGAGATGGAAGCTTGTCTTGATATTTTGGAACCAGCTATGTACAAAGT
                      ____________________________________________________________
consensus GTGATTGATTAAAGAGATGGAAGCTTGTCTTGATATTTTGGAACCAGCTATGTACAAAGT
 
. : . : . : . : . : . :
rJMFF019B22+ GGTTTAAATGTTAAAGAGATTGAATTTGTTATGTGAACTTAATGCCAGGCATTACAATTA
rJMFF005M24+ GGTTTAAATGTTAA
rJMFF005A05+ GGTTTAAATGTTAAAGAGATTGAATTTGTTATGTGAACTTAATGCCAGGCATTACAATTA
rJMFF012P19+ GGTTTAAATGTTAAAGAGATTGAATTTGTTATGTGAACTTAATGCCAGGCATTACAATTA
rJMFF051E16+ GGTTTAAATGTTAAAGAGATTGAATTTGTTATGTGAACTTAATGCCAGGCATTACAATTA
                      ____________________________________________________________
consensus GGTTTAAATGTTAAAGAGATTGAATTTGTTATGTGAACTTAATGCCAGGCATTACAATTA
 
. : . : . : . : . : . :
rJMFF019B22+ ACTAT
rJMFF005A05+ ACTAT
rJMFF012P19+ ACTATTAAGGAGGC
rJMFF051E16+ ACTATTAAGGAGGCATATTATGTTTAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus ACTATTAAGGAGGCATATTATGTTTAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT