Previous Contig 011063:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O04Sequence399000114 (10)721011063 (5)gb:AY136385_15818863e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185
JMFF021I24Sequence522000114 (10)247011063 (5)
JMFF023A13Sequence530011063 (5)gb:AY136385_15818864e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185
JMFF051D17Sequence624000114 (10)gb:AY371292_16030554e-11Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.551011063 (5)gb:AY136385_15818862e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185
JMFF051P21Sequence624000114 (10)gb:AY371292_16030556e-07Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.558011063 (5)gb:AY136385_15818862e-11Arabidopsis thaliana unknown protein (At2g25930) mRNA, complete cds.>gb:BT000185

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002O04+ AC
                      ____________________________________________________________
consensus AC
 
. : . : . : . : . : . :
rJMFF002O04+ TAAAGATGCAAAGCACACAAGGGGAAGAAATTTGAGACATCAGGAGAGCTCAAGACAGCT
                      ____________________________________________________________
consensus TAAAGATGCAAAGCACACAAGGGGAAGAAATTTGAGACATCAGGAGAGCTCAAGACAGCT
 
. : . : . : . : . : . :
rJMFF002O04+ TCCTGCAACCAGAGAGCAGTCTGTTAAAGCTTCCTTGAGTTCTCGATCCACAGATAAGAA
                      ____________________________________________________________
consensus TCCTGCAACCAGAGAGCAGTCTGTTAAAGCTTCCTTGAGTTCTCGATCCACAGATAAGAA
 
. : . : . : . : . : . :
rJMFF023A13+ CTTGCATTNTGAACAGAGAGATGG
rJMFF002O04+ AGAACATTGTATAAAGCATACTGATACGGATTTTCCCTTGCATTCTGAACAGAGAGATGG
                      ____________________________________________________________
consensus AGAACATTGTATAAAGCATACTGATACGGATTTTCCCTTGCATTCTGAACAGAGAGATGG
 
. : . : . : . : . : . :
rJMFF023A13+ CCCTGCAAATAATTNTGACNTGTCACATAAGAGTGGCATAAACCTACAACCAGAAAGCAT
rJMFF002O04+ CCCTGCAAATAATTCTGACCTGTCACATAAGAGTGGCATAAACCTACAACCAGAAAGCAT
rJMFF051P21+ CCTGCAAATAATTCTGACCTGTCACATAAGAGTGGCATAAACCTACAACCAGAAAGCAT
rJMFF051D17+ CCAGAAAGCAT
                      ____________________________________________________________
consensus CCCTGCAAATAATTCTGACCTGTCACATAAGAGTGGCATAAACCTACAACCAGAAAGCAT
 
. : . : . : . : . : . :
rJMFF023A13+ AATNGATTNTAAAGTTGGTGACGCTAATGATGATGCTGTTGTGAGTGGGCCTATTAAGGG
rJMFF002O04+ AATTGATTCTAAAGTTGGTGACGCTAATGATGATGCTGTTGTGAGTGGGCCTATTAAGGG
rJMFF051P21+ AATTGATTCTAAAGTTGGTGACGCTAATGATGATGCTGTTGTGAGTGGGCCTATTAAGGG
rJMFF051D17+ AATTGATTCTAAAGTTGGTGACGCTAATGATGATGCTGTTGTGAGTGGGCCTATTAAGGG
                      ____________________________________________________________
consensus AATTGATTCTAAAGTTGGTGACGCTAATGATGATGCTGTTGTGAGTGGGCCTATTAAGGG
 
. : . : . : . : . : . :
rJMFF023A13+ TGTGGAAATTGGAGATTCTTCTGTCCCAATCAATTGTTTTCAAACAGAAGGGCAGATTAT
rJMFF002O04+ TGTGGAAATTGGAGATTCTTCTGTCCCAATCAATTGTTTTCAAACAGAAGGGCAGATTAT
rJMFF051P21+ TGTGGAAATTGGAGATTCTTCTGTCCCAATCAATTGTTTTCAAACAGAAGGGCAGATTAT
rJMFF051D17+ TGTGGAAATTGGAGATTCTTCTGTCCCAATCAATTGTTTTCAAACAGAAGGGCAGATTAT
                      ____________________________________________________________
consensus TGTGGAAATTGGAGATTCTTCTGTCCCAATCAATTGTTTTCAAACAGAAGGGCAGATTAT
 
. : . : . : . : . : . :
rJMFF023A13+ TAATGTTGGTAATGATGTGGAGTCTCAGGAAAACCAGACATGTAGATCACCACAAACACA
rJMFF002O04+ TAATGTTGGTAATGATGTGGAGTCTCAGGAAAACCAGACATGTAGATCACCACAAACACA
rJMFF051P21+ TAATGTTGGTAATGATGTGGAGTCTCAGGAAAACCAGACATGTAGATCACCACAAACACA
rJMFF051D17+ TAATGTTGGTAATGATGTGGAGTCTCAGGAAAACCAGACATGTAGATCACCACAAACACA
                      ____________________________________________________________
consensus TAATGTTGGTAATGATGTGGAGTCTCAGGAAAACCAGACATGTAGATCACCACAAACACA
 
. : . : . : . : . : . :
rJMFF023A13+ AAAAGTTGATAGAGGAGACAACTCATNTGAGACTTCCATGGTGGAATGTATATCTGGAAT
rJMFF021I24+ GGTGGAATGTATATNTGGAAT
rJMFF002O04+ AAAAGTTGATAGAGGAGACAACTCATCTGAGACTTCCATGGTGGAATGTATATCTGGAAT
rJMFF051P21+ AAAAGTTGATAGAGGAGACAACTCATCTGAGACTTCCATGGTGGAATGTATATCTGGAAT
rJMFF051D17+ AAAAGTTGATAGAGGAGACAACTCATCTGAGACTTCCATGGTGGAATGTATATCTGGAAT
                      ____________________________________________________________
consensus AAAAGTTGATAGAGGAGACAACTCATCTGAGACTTCCATGGTGGAATGTATATCTGGAAT
 
. : . : . : . : . : . :
rJMFF023A13+ GGACATATCGCCCGATGATGTAGTTGGAATAATTGGCCAAAAACATTTTTGGAAAGCCAG
rJMFF021I24+ GGNCATATCGNNCGANGATGTAGTTGGAATAANTGGCCAAAANCATTNTNGGAAAGCCAG
rJMFF002O04+ GGACATATCGCCCGATGATGTAGTTGGAATAATTGGCCAAAAACATTTTTGGAAAGCCAG
rJMFF051P21+ GGACATATCGCCCGATGATGTAGTTGGAATAATTGGCCAAAAACATTTTTGGAAAGCCAG
rJMFF051D17+ GGACATATCGCCCGATGATGTAGTTGGAATAATTGGCCAAAAACATTTTTGGAAAGCCAG
                      ____________________________________________________________
consensus GGACATATCGCCCGATGATGTAGTTGGAATAATTGGCCAAAAACATTTTTGGAAAGCCAG
 
. : . : . : . : . : . :
rJMFF023A13+ AAGAGCTATTGTCAAGTAAGTTCATTCTTGGATTTTTGAGTCTCACTCTTTAGGCTTCAT
rJMFF021I24+ AAGAGCTATTGTCAAGTAAGTTCATTCTTGGATTTTTGAGTCTCACTCTTTAGGCTTCAT
rJMFF002O04+ AAGAGCTATTGTCAAGTAAGTTCATTCTTGGATTTTTGAGTCTCACTCTTTAGGCTTCAT
rJMFF051P21+ AAGAGCTATTGTCAAGTAAGTTCATTCTTGGATTTTTGAGTCTCACTCTTTAGGCTTCAT
rJMFF051D17+ AAGAGCTATTGTCAAGTAAGTTCATTCTTGGATTTTTGAGTCTCACTCTTTAGGCTTCAT
                      ____________________________________________________________
consensus AAGAGCTATTGTCAAGTAAGTTCATTCTTGGATTTTTGAGTCTCACTCTTTAGGCTTCAT
 
. : . : . : . : . : . :
rJMFF023A13+ ATGTTCTATTCTAATTCCCTGTGTTTCTATAGGATCAATATGTATTTTCTTTCATTTACT
rJMFF021I24+ ATGTTCTATTCTAATTCCCTGTGTTTCTATAGGATCAATATGTATTTTCTTTCATTTACT
rJMFF002O04+ ATGTTCTATTCTAATTCCCTGTGTTTCTATAGGATCAATATGTATTTTCTTTCATTTACT
rJMFF051P21+ ATGTTCTATTCTAATTCCCTGTGTTTCTATAGGATCAATATGTATTTTCTTTCATTTACT
rJMFF051D17+ ATGTTCTATTCTAATTCCCTGTGTTTCTATAGGATCAATATGTATTTTCTTTCATTTACT
                      ____________________________________________________________
consensus ATGTTCTATTCTAATTCCCTGTGTTTCTATAGGATCAATATGTATTTTCTTTCATTTACT
 
. : . : . : . : . : . :
rJMFF023A13+ TGTGAGCTTAATATTATACAGTGCAC
rJMFF021I24+ TGTGAGCTTAATATTATACAGTGCACATTTATGTTCTTGATTCC
rJMFF002O04+ TGTGAGCTTAATATTATACAGTGCACATTTATGTTCTTGATTCCATTTTTTAATAATCA
rJMFF051P21+ TGTGAGCTTAATATTATACAGTGCACATTTATGTTCTTGATTCCATTTTTTAATAATCAT
rJMFF051D17+ TGTGAGCTTAATATTATACAGTGCACATTTATGTTCTTGATTCCATTTTTTAATAATCAT
                      ____________________________________________________________
consensus TGTGAGCTTAATATTATACAGTGCACATTTATGTTCTTGATTCCATTTTTTAATAATCAT
 
. : . : . : . : . : . :
rJMFF051P21+ GATATAATTAGAAAATGAT
rJMFF051D17+ GATATAATTAGAAAATGATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GATATAATTAGAAAATGATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG