Previous Contig 011060:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025P16Sequence566002189 (3)gb:ATT4L20_15560522e-56Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project).715011060 (2)gb:AC133930_17416057e-55Oryza sativa chromosome 3 BAC OSJNBa0039O18 genomic sequence, complete sequence.
JMFF051D03Sequence607002189 (3)gb:ATT4L20_15560529e-58Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project).523011060 (2)gb:AF249675_17807796e-26Olea europaea beta-1,3-glucanase-like protein (OLE9) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025P16+ AGGTCCATGGTCGGAACTCCATTGATGCCGGGAAAATCAGTGGACA
                      ____________________________________________________________
consensus AGGTCCATGGTCGGAACTCCATTGATGCCGGGAAAATCAGTGGACA
 
. : . : . : . : . : . :
rJMFF025P16+ CCTATCTGTTCGCATTGTACGACGAGGATCTGAAGCCCGGACCAACGTCCGAGAGATCCT
                      ____________________________________________________________
consensus CCTATCTGTTCGCATTGTACGACGAGGATCTGAAGCCCGGACCAACGTCCGAGAGATCCT
 
. : . : . : . : . : . :
rJMFF025P16+ TCGGTCTCTATAACACCGATTTAACCATGACCTATGATGCTGGACTTTCAAAATCATCCA
                      ____________________________________________________________
consensus TCGGTCTCTATAACACCGATTTAACCATGACCTATGATGCTGGACTTTCAAAATCATCCA
 
. : . : . : . : . : . :
rJMFF025P16+ CCCAGACTCCGACGACGCCAAAGAGTGCTCCGGCGATCGGTCCTCCGGCGTCAAAGAAGA
                      ____________________________________________________________
consensus CCCAGACTCCGACGACGCCAAAGAGTGCTCCGGCGATCGGTCCTCCGGCGTCAAAGAAGA
 
. : . : . : . : . : . :
rJMFF025P16+ ATAGTAGCTGGTGGTGCGTGCCCAAGGGTGGGGTATCAGATGCCCAGTTGCAAGCAAATC
                      ____________________________________________________________
consensus ATAGTAGCTGGTGGTGCGTGCCCAAGGGTGGGGTATCAGATGCCCAGTTGCAAGCAAATC
 
. : . : . : . : . : . :
rJMFF025P16+ TAGATTATGCTTGTGCACTACAAGGAATTGATTGTAGCCCAATCCAGCCCGGAGGGGCCT
rJMFF051D03+ CTACAAGGAATTGATTGTAGCCCAATCCAGCCCGGAGGGGCCT
                      ____________________________________________________________
consensus TAGATTATGCTTGTGCACTACAAGGAATTGATTGTAGCCCAATCCAGCCCGGAGGGGCCT
 
. : . : . : . : . : . :
rJMFF025P16+ GTTTCGAGCCCAACACAATCGCATCTCATGCTACATACGCCATGAACCTCGTATACCAAT
rJMFF051D03+ GTTTCGAGCCCAACACAATCGCATCTCATGCTACATACGCCATGAACCTCGTATACCAAT
                      ____________________________________________________________
consensus GTTTCGAGCCCAACACAATCGCATCTCATGCTACATACGCCATGAACCTCGTATACCAAT
 
. : . : . : . : . : . :
rJMFF025P16+ CATCGGAAAAGAATTCATGGAATTGTGATTTCTCACAAACAGCCACCCTCACCTCCAACA
rJMFF051D03+ CATCGGAAAAGAATTCATGGAATTGTGATTTCTCACAAACAGCCACCCTCACCTCCAACA
                      ____________________________________________________________
consensus CATCGGAAAAGAATTCATGGAATTGTGATTTCTCACAAACAGCCACCCTCACCTCCAACA
 
. : . : . : . : . : . :
rJMFF025P16+ ATCCTAGTTATAATGGATGTAGCTATCCTGGGGGAAGTGTCTGATCTGAGAAGGCTGTGT
rJMFF051D03+ ATCCTAGTTATAATGGATGTAGCTATCCTGGGGGAAGTGTCTGATCTGAGAAGGCTGTGT
                      ____________________________________________________________
consensus ATCCTAGTTATAATGGATGTAGCTATCCTGGGGGAAGTGTCTGATCTGAGAAGGCTGTGT
 
. : . : . : . : . : . :
rJMFF025P16+ AATCAACTTGTAGGTGTCCATGTTTGAGTGGTTGTTTATTCTTATTGTTGTGTACTACGT
rJMFF051D03+ AATCAACTTGTAGGTGTCCATGTTTGAGTGGTTGTTTATTCTTATTGTTGTGTACTACTT
                      ____________________________________________________________
consensus AATCAACTTGTAGGTGTCCATGTTTGAGTGGTTGTTTATTCTTATTGTTGTGTACTACTT
 
. : . : . : . : . : . :
rJMFF025P16+ TGGTGAATGGTGAGGAAAGTAGATTTTGCGTGGATAAGAATGAAGGATTCATGCAAACAA
rJMFF051D03+ TGGTGAATGGTGAGGAAAGTAGATTTTGCGTGGATAAGAATGAAGGATTCATGCAAACAA
                      ____________________________________________________________
consensus TGGTGAATGGTGAGGAAAGTAGATTTTGCGTGGATAAGAATGAAGGATTCATGCAAACAA
 
. : . : . : . : . : . :
rJMFF025P16+ GTTTTCTATTTATGAGTGATCTTTCCTTAATGTAAACTAATGGACTTCCAACATTATTGT
rJMFF051D03+ GTTTTCTATTTATGAGTGATCTTTCCTTAATGTAAACTAATGGACTTCCAACATTATTGT
                      ____________________________________________________________
consensus GTTTTCTATTTATGAGTGATCTTTCCTTAATGTAAACTAATGGACTTCCAACATTATTGT
 
. : . : . : . : . : . :
rJMFF025P16+ GTGTTACGT
rJMFF051D03+ GTGTTACGTTGTATTTTAATGGACCTCAAATCCTTTGGGCCTCTTTTGGTTATTTATTGG
                      ____________________________________________________________
consensus GTGTTACGTTGTATTTTAATGGACCTCAAATCCTTTGGGCCTCTTTTGGTTATTTATTGG
 
. : . : . : . : . : . :
rJMFF051D03+ ACTTTTTTTTTTTGCATTGGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ACTTTTTTTTTTTGCATTGGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG