Previous Contig 011059:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I10Sequence485000146 (17)706011059 (15)gb:AY308957_15978602e-41Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMFF026I11Sequence251000146 (17)718011059 (15)gb:AY308957_15978602e-43Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMFF032D02Sequence476000146 (17)557011059 (15)gb:AY308957_15978604e-31Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMFF051D01Sequence640000146 (17)gb:AY308957_15978601e-35Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.636011059 (15)gb:AY308957_15978605e-32Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMFN007F09Sequence578011059 (15)gb:AC103551_17372955e-28Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete sequence.
JMFN029K06Sequence504011059 (15)gb:AY308957_15978602e-27Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMFN044J04Sequence519011059 (15)gb:AY308957_15978601e-32Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF009D13Sequence158000146 (17)760011059 (15)gb:AY308957_15978602e-43Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF016G24Sequence743011059 (15)gb:AY308957_15978601e-46Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF017M11Sequence471000146 (17)gb:AP005755_18572723e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN774011059 (15)gb:AY308957_15978602e-45Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF032M19Sequence638000146 (17)gb:AY308957_15978603e-29Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.657011059 (15)gb:AY308957_15978602e-41Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF035F11Sequence627000146 (17)gb:AY308957_15978607e-26Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.729011059 (15)gb:AY308957_15978606e-44Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF039A23Sequence685000146 (17)gb:AY308957_15978602e-58Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.816011059 (15)gb:AY308957_15978605e-55Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF046A24Sequence189000146 (17)708011059 (15)gb:AY308957_15978602e-43Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF051E20Sequence615000146 (17)gb:AY308957_15978602e-27Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.756011059 (15)gb:AY308957_15978603e-45Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039A23+ CCCATGCTTTGATATCAGATGAAACCTTTTCAGT
                      ____________________________________________________________
consensus CCCATGCTTTGATATCAGATGAAACCTTTTCAGT
 
. : . : . : . : . : . :
rJMSF039A23+ AATTTCCAAGGAGTGCGACTACATTCATACCAACTTTTCTGCCACCTGCAAAATTTACCA
                      ____________________________________________________________
consensus AATTTCCAAGGAGTGCGACTACATTCATACCAACTTTTCTGCCACCTGCAAAATTTACCA
 
. : . : . : . : . : . :
rJMSF039A23+ AGCCAAAGCACTTATGGAGAT-GGGACCTGTNAA-CGTGACTAACATTTACACTAACTTC
rJMSF009D13+ GCAATTATCGAGAT-GGGACTTGTTAANCATGCAAAGCATTTACAGTAATTAC
rJMSF035F11+ TCGAGAT-GGGACTTGTTAA-CATGCAAAGCATTTACAGTAATTAC
rJMSF046A24+ GCAATTATCGAGATGGGGACTTGTTAA-CATGCAAAGCATTTACAGTAATTAC
rJMSF051E20+ GCAATTATCGAGAT-GGGACTTGTTAA-CATGCAAAGCATTTACAGTAATTAC
                      ____________________________________________________________
consensus AGCCAAAGCAATTATCGAGAT-GGGACTTGTTAA-CATGCAAAGCATTTACAGTAATTAC
 
. : . : . : . : . : . :
rJMSF039A23+ TGCTTTAATGGTGTCGCAAAACCACAATATCATGGTTTGGAAAATGATCC-TTGCTCAGG
rJMSF016G24+ GAAAATGATCC-TTGCCCAGG
rJMSF009D13+ TGCTTTAATGATGTCCCAAAACCACAACATCATCGTATGGAATATGATCC-TTGCTCAGG
rJMSF035F11+ TGCTTTAATGATGTCCCAAAACCACAACATCATCGTATGGAATATGATCC-TTGCTCAGG
rJMSF046A24+ TGCTTTAATGATGTCCCAAAACCACAACATCATCGTATGGAATATGATCC-TTGCTCAGG
rJMSF051E20+ TGCTTTAATGATGTCCCAAAACCACAACATCATCGTATGGAATATGATCC-TTGCTCAGG
rJMSF017M11+ ATGATCC-TTGCTCAGG
rJMSF032M19+ AATATGATCC-NTGCTCAGG
rJMFF026I11+ CCACAACATCATNGTATGGAATATGATCC-TTGCTCAGG
rJMFF003I10+ GTATGGAATATGATCCTTTGCTCAGG
                      ____________________________________________________________
consensus TGCTTTAATGATGTCCCAAAACCACAACATCATCGTATGGAATATGATCC-TTGCTCAGG
 
. : . : . : . : . : . :
rJMSF039A23+ CAGTTATGTCACGTCTTACCTCAACCGAGACGAGGTGCAGAAGGCCCTCCATGCCATCAA
rJMSF016G24+ CGATTCTGTCGTGTCTTACCTCAACCGAGACGAGGTGCAGAAGGCCCTCCATGCCATCAA
rJMSF009D13+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMSF035F11+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMSF046A24+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMSF051E20+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMSF017M11+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMSF032M19+ CGGTTATGTCATGGCTTACNTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMFF026I11+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
rJMFF003I10+ CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
                      ____________________________________________________________
consensus CGGTTATGTCATGGCTTACCTCAACCGAGAGGAGGTGCAGAAGGCCCTCCATGCCACCAG
 
. : . : . : . : . : . :
rJMSF039A23+ CACTTCTTGGATAGGTTGCAGTCCAAAATTTGGATTGAGTCATTGGAAAGACGCACCAAT
rJMSF016G24+ CACTTCTTGGATAGGTTGCAGTCCAAAATTTGGATTGACTCATTGGAAAGACTCAGCAAT
rJMSF009D13+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMSF035F11+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMSF046A24+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMSF051E20+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMSF017M11+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMSF032M19+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAANTCAGCAAT
rJMFF026I11+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMFF032D02+ GGAAGAACTCAGCAAT
JMFN044J04- TTGGATCGAGTAATTGGAAGAACTCAGCAAT
JMFN007F09+ AAAGTTGGATCGAGTAATTGGAAGATCTCAGCCAT
rJMFF003I10+ AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
rJMFF051D01+ CCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
                      ____________________________________________________________
consensus AGCTTTTTGGATGGTTTGCAGTCCAAAAGTTGGATCGAGTAATTGGAAGAACTCAGCAAT
 
. : . : . : . : . : . :
rJMSF039A23+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAACAAGATAAAAGTATGGATATACAG
rJMSF016G24+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAACAAGATAAAAGTATGGCTATACAG
rJMSF009D13+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMSF035F11+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMSF046A24+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMSF051E20+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMSF017M11+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMSF032M19+ AACAACCTTGCCCATAATCAAGCAGNTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMFF026I11+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMFF032D02+ AACANCNTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
JMFN044J04- AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
JMFN007F09+ ACCAACCTTGGCCATAATCAAGCCGCTCATTGCAAAGAAGTTACAAGTATGGATATACAG
JMFN029K06- TCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMFF003I10+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
rJMFF051D01+ AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
                      ____________________________________________________________
consensus AACAACCTTGCCCATAATCAAGCAGCTCATTGCAAAGAAGTTAAAAGTATGGATATACAG
 
. : . : . : . : . : . :
rJMSF039A23+ TGGTGACGTAGATGCATTAGTTTCAGTGACATCAACCAGGTATGCAATAAAAGCGATGAA
rJMSF016G24+ TGGTGACGTAGATGCATTAGTTTCAGTGACATCAACCAGATATGCAATAAAAGCGATGAA
rJMSF009D13+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMSF035F11+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMSF046A24+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMSF051E20+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMSF017M11+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMSF032M19+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMFF026I11+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMFF032D02+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
JMFN044J04- TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
JMFN007F09+ TGGTGACGTAGATGCATTAGGTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
JMFN029K06- TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMFF003I10+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
rJMFF051D01+ TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
                      ____________________________________________________________
consensus TGGTGACGTAGATGCATTAGTTTCAGTAACATCAACCAGGTATGCAATAAAAGCCATGAA
 
. : . : . : . : . : . :
rJMSF039A23+ ACTTCCCGTCGAGGTTGGTTGGCGGGCGTGGCATTCTGATGGCGCCAAGGATGTGGGAGG
rJMSF016G24+ ACTTCCTGTCGAGGTTGGTTGGCGGGCGTGGCATTCTGATGGCGCCAAGGATGTGGGAGG
rJMSF009D13+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMSF035F11+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMSF046A24+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMSF051E20+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMSF017M11+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMSF032M19+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTNTGATGGCACCAAGGATGTGGGAGG
rJMFF026I11+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMFF032D02+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
JMFN044J04- ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
JMFN007F09+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
JMFN029K06- ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMFF003I10+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
rJMFF051D01+ ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
                      ____________________________________________________________
consensus ACTTCCTGTCGAGGTTGCTTGGCGGGCGTGGCATTCTGATGGCACCAAGGATGTGGGAGG
 
. : . : . : . : . : . :
rJMSF039A23+ GCACGTGGAAGCGTACGAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTTAGC
rJMSF016G24+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACTATAAGAGGAGGGGGGCATTCAGC
rJMSF009D13+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMSF035F11+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMSF046A24+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMSF051E20+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMSF017M11+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMSF032M19+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMFF026I11+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMFF032D02+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
JMFN044J04- GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
JMFN007F09+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
JMFN029K06- GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMFF003I10+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
rJMFF051D01+ GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
                      ____________________________________________________________
consensus GTACGTGGAAGCGTACAAGGGATTGACACTGGTTACAATAAGAGGAGCTGGGCATTCAGC
 
. : . : . : . : . : . :
rJMSF039A23+ TCCTAGCTACCAACCAGAACGTGCATTTACTATGATTTCATCTTTCCTTCAAGGGAAACT
rJMSF016G24+ TCCAAGCTACCAACCAGAACGTGCATTTACTATGATTTCATCTTTCCTTCAAGGGAAACT
rJMSF009D13+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMSF035F11+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMSF046A24+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMSF051E20+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMSF017M11+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMSF032M19+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMFF026I11+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMFF032D02+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
JMFN044J04- TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
JMFN007F09+ TCCTAGCTACCAACCAGAACGTGCATTGGCTATGATTTCATCCTTCCCTCATGGGAAACT
JMFN029K06- TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMFF003I10+ TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
rJMFF051D01+ TCCTAGCTACCAACCAGAACGTGCATTGAGTATGATTTCATCCTTCCTTCATGGGAAACT
                      ____________________________________________________________
consensus TCCTAGCTACCAACCAGAACGTGCATTGACTATGATTTCATCCTTCCTTCATGGGAAACT
 
. : . : . : . : . : . :
rJMSF039A23+ CCCCCCTCCCTTCAGCTAG
rJMSF016G24+ CCCCCCTGCCTTCAGCTAG
rJMSF009D13+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMSF035F11+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMSF046A24+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMSF051E20+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMSF017M11+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMSF032M19+ TCCCCCTGCNTTCAGNTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMFF026I11+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMFF032D02+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
JMFN044J04- TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
JMFN007F09+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTTGTGGCAACTGCGACCT
JMFN029K06- TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMFF003I10+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
rJMFF051D01+ TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
                      ____________________________________________________________
consensus TCCCCCTGCCTTCAGCTAGGTGTGATAGAAACGAAAACAAACTCGTGGCAACTGCGACCT
 
. : . : . : . : . : . :
rJMSF009D13+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMSF035F11+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMSF046A24+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMSF051E20+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMSF017M11+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMSF032M19+ ANTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTNCCTCTATATCA
rJMFF026I11+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMFF032D02+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
JMFN044J04- ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
JMFN007F09+ AATGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAAGATATTACCTCTATATCA
JMFN029K06- ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMFF003I10+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
rJMFF051D01+ ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
                      ____________________________________________________________
consensus ACTGATTTCCATAGTGGCAACTGTTCAGCCACATGCTAATAA-ATATTACCTCTATATCA
 
. : . : . : . : . : . :
rJMSF009D13+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMSF035F11+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMSF046A24+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAA
rJMSF051E20+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMSF017M11+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMSF032M19+ AGAAGATGCTGAGAAAAAGCTGTANGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMFF026I11+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMFF032D02+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
JMFN044J04- AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
JMFN007F09+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCCAACCCAT
JMFN029K06- AGAAGATGCTGAGAAAAAGCTGTATGTACTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMFF003I10+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
rJMFF051D01+ AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
                      ____________________________________________________________
consensus AGAAGATGCTGAGAAAAAGCTGTATGTAGTTAAACAGCCCTACAAATGCACCAAACCCAT
 
. : . : . : . : . : . :
rJMSF009D13+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCAT
rJMSF035F11+ CTCCTTTCTATTTTCTATCAACATTCT
rJMSF051E20+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATT
rJMSF017M11+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATT
rJMSF032M19+ CTCCTTTCTATTTTCTATCAACATTCTG--AATTCACAGAT
rJMFF026I11+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATTGTTCTGTATGGAGAG
rJMFF032D02+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATTGTTCTGTATGGAGAG
JMFN044J04- CTCCTTTCT
JMFN007F09+ CTCCCTTCTATTTTCTATCAACATTTTTGTTATTCACAGATCATTGTTCTGTATGGA
JMFN029K06- CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATTGTTCTGT
rJMFF003I10+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATTGTTCTGTATGGAGAG
rJMFF051D01+ CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATTGTTCTGTATGGAGAG
                      ____________________________________________________________
consensus CTCCTTTCTATTTTCTATCAACATTCTTG-AATTCACAGATCATTGTTCTGTATGGAGAG
 
. : . : . : . : . : . :
rJMFF026I11+ TGAACTGCAGATGCAACAAACC
rJMFF003I10+ TGAACTGCAGATGCAACAAACC
rJMFF051D01+ TGAACTGCAGATGCAACAAACCAAGTTTCCAGCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGAACTGCAGATGCAACAAACCAAGTTTCCAGCAAAAAAAAAAAAAAAACTCTCCAGGGT