Previous Contig 011057:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043B18Sequence628006002 (8)gb:AP004753_18444284e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050530011057 (8)gb:AP004753_18444283e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMFF051C18Sequence555006002 (8)gb:AP004753_18444289e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050614011057 (8)gb:AP004753_18444284e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMFF051I16Sequence554006002 (8)gb:AP004753_18444281e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050532011057 (8)gb:AP004753_18444282e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMFF051K16Sequence555006002 (8)gb:AP004753_18444287e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050493011057 (8)gb:AP004753_18444282e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMSF002L24Sequence391006002 (8)gb:AP004753_18444282e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050748011057 (8)gb:AP004753_1844428e-105Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMSF009C07Sequence285006002 (8)717011057 (8)gb:AP004753_18444283e-96Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMSF021J21Sequence627006002 (8)gb:AP004753_18444283e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050764011057 (8)gb:AP004753_1844428e-102Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050
JMSF021P20Sequence664006002 (8)gb:AP004753_18444283e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050720011057 (8)gb:AP004753_18444283e-95Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P050

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009C07+ TACAG
rJMSF002L24+ TTACAG
                      ____________________________________________________________
consensus TTACAG
 
. : . : . : . : . : . :
rJMSF009C07+ AGGGAATTTTGCAACAATTTGGTTTTGATAATTATGAGGTCAACCTTTCAACAAGGCCAG
rJMSF002L24+ AGGGAATTTTGCAACAATTTGGTTTTGATAATTATGAGGTCAACCTTTCAACAAGGCCAG
rJMSF021P20+ GGCCAG
rJMSF021J21+ TTGGTTTTGATAATTATGAGGTCAACCTTTCAACAAGGCCAG
                      ____________________________________________________________
consensus AGGGAATTTTGCAACAATTTGGTTTTGATAATTATGAGGTCAACCTTTCAACAAGGCCAG
 
. : . : . : . : . : . :
rJMSF009C07+ AGAAATCCGTGGGAAATGATGATATATGGGAAAAAGCAACTTCTGCACTTAAGGATGCTT
rJMSF002L24+ AGAAATCCGTGGGAAATGATGATATATGGGAAAAAGCAACTTCTGCACTTAAGGATGCTT
rJMSF021P20+ AGAAATCCGTGGGAAATGATGATATATGGGAAAAAGCAACTTCTGCACTTAAGGATGCTT
rJMSF021J21+ AGAAATCCGTGGGAAATGATGATATATGGGAAAAAGCAACTTCTGCACTTAAGGATGCTT
                      ____________________________________________________________
consensus AGAAATCCGTGGGAAATGATGATATATGGGAAAAAGCAACTTCTGCACTTAAGGATGCTT
 
. : . : . : . : . : . :
rJMSF009C07+ TGAACGACAAATGTTGGACTTATCAGATAGATGAAGGAGGTGGTGCCTTTTATGGTCCTA
rJMSF002L24+ TGAACGACAAAGGTTGGACTTATCAGATAGATGAAGGAGGTGGTGCCTTTTATGGTCCTA
rJMSF021P20+ TGAACGACAAATGTTGGACTTATCAGATAGATGAAGGAGGTGGTGCCTTTTATGGTCCTA
rJMSF021J21+ TGAACGACAAAGGTTGGACTTATCAGATAGATGAAGGAGGTGGTGCCTTTTATGGTCCTA
                      ____________________________________________________________
consensus TGAACGACAAATGTTGGACTTATCAGATAGATGAAGGAGGTGGTGCCTTTTATGGTCCTA
 
. : . : . : . : . : . :
rJMSF009C07+ AGATCGATCTCAAAATCGAGGATGCTCTAGGAAGAAAGTGGCAATGCTCAACCATNCAGG
rJMSF002L24+ AGATCGATCTCAAAATCGAGGATGCTCTAGGAAGAAAGTGGCAATGCTCAACCATACAGG
rJMSF021P20+ AGATCGATCTCAAAATCGAGGATGCTCTAGGAAGAAAGTGGCAATGCTCAACCATACAGG
rJMSF021J21+ AGATCGATCTCAAAATCGAGGATGCTCTAGGAAGAAAGTGGCAATGCTCAACCATACAGG
                      ____________________________________________________________
consensus AGATCGATCTCAAAATCGAGGATGCTCTAGGAAGAAAGTGGCAATGCTCAACCATACAGG
 
. : . : . : . : . : . :
rJMSF009C07+ TGGATTTTAATTTACCGGAGCGTTTTGACATGACATATGTTGACTCGGACCAAGAGAAGA
rJMSF002L24+ TGGATTTTAATTTACCGGAGCGTTTTGACATGACATATGTTGACTCGGACCAAGAGAAGA
rJMSF021P20+ TGGATTTTAATTTACCGGAGCGTTTTGACATGACATATGTTGACTCGGACCAAGAGAAGA
rJMSF021J21+ TGGATTTTAATTTACCGGAGCGTTTTGACATGACATATGTTGACTCGGACCAAGAGAAGA
rJMFF043B18+ TCGGACCAAGAGAAGA
rJMFF051C18+ ACTCGGACCAAGAGAAGA
                      ____________________________________________________________
consensus TGGATTTTAATTTACCGGAGCGTTTTGACATGACATATGTTGACTCGGACCAAGAGAAGA
 
. : . : . : . : . : . :
rJMSF009C07+ AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
rJMSF002L24+ AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
rJMSF021P20+ AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
rJMSF021J21+ AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
rJMFF043B18+ AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
rJMFF051I16+ TTGGAGTCC
rJMFF051C18+ AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
                      ____________________________________________________________
consensus AGCGCCCAATCTTAATCCACCGAGCTGTTCTTGGATCTCTGGAGCGGTTCTTTGGAGTCC
 
. : . : . : . : . : . :
rJMSF009C07+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMSF002L24+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMSF021P20+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMSF021J21+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMFF043B18+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMFF051I16+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMFF051K16+ TAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
rJMFF051C18+ TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
                      ____________________________________________________________
consensus TAATAGAGCATTATGCCGGCGATTTTCCTTTATGGCTTTCTCCAATCCAAACAAGACTTA
 
. : . : . : . : . : . :
rJMSF009C07+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
rJMSF002L24+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACGAGGTGGAGAAGAGACTAAAGGCGA
rJMSF021P20+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
rJMSF021J21+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACGAGGTGGAGAAGAGACTAAAGGCGA
rJMFF043B18+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
rJMFF051I16+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
rJMFF051K16+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
rJMFF051C18+ TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
                      ____________________________________________________________
consensus TACCCGTGACTGACACACAGCTTGAGTTTTGCAACAAGGTGGAGAAGAGACTAAAGGCGA
 
. : . : . : . : . : . :
rJMSF009C07+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
rJMSF002L24+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTACCAAAGCTCATTAGAAACGCAG
rJMSF021P20+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
rJMSF021J21+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTACCAAAGCTCATTAGAAACGCAG
rJMFF043B18+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
rJMFF051I16+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
rJMFF051K16+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
rJMFF051C18+ GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
                      ____________________________________________________________
consensus GCGGCATTCGTGCCGAGGTTTGCAGCGGTGAGCGTTTGCCAAAGCTCATTAGAAACGCAG
 
. : . : . : . : . : . :
rJMSF009C07+ AGAAGCAGAAGATCCCANTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMSF002L24+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMSF021P20+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMSF021J21+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMFF043B18+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMFF051I16+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMFF051K16+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
rJMFF051C18+ AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
                      ____________________________________________________________
consensus AGAAGCAGAAGATCCCATTGATGGCTGTCGTCGGGCCAAAAGAAGTGGAAAGTGATGCAG
 
. : . : . : . : . : . :
rJMSF009C07+ TGACAATCAGATCAAGATTTGGTGGTGAATTACGGGACCATGCAGATTGATGACTTCATC
rJMSF002L24+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
rJMSF021P20+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
rJMSF021J21+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
rJMFF043B18+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
rJMFF051I16+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
rJMFF051K16+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
rJMFF051C18+ TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
                      ____________________________________________________________
consensus TGACAATCAGATCAAGATTTGGTGGTGAATTA-GGGACCATGCAGATTGATGACTTCATC
 
. : . : . : . : . : . :
rJMSF009C07+ AGAGAAGCCAAGAATGCAATTGAGAACNGAACATTCTTTTGAAGTGTATACC
rJMSF002L24+ AGAAAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
rJMSF021P20+ AGAGAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
rJMSF021J21+ AGAAAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
rJMFF043B18+ AGAGAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
rJMFF051I16+ AGAGAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
rJMFF051K16+ AGAGAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
rJMFF051C18+ AGAGAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
                      ____________________________________________________________
consensus AGAGAAGCCAAGAATGCAATTGAGAACAGAACATTCTTTTGAAGTGTATACCTTTGACTG
 
. : . : . : . : . : . :
rJMSF002L24+ TCGAACTCGCTGTGTTATGCGTT
rJMSF021P20+ TCGAACTCGCTGTGTTATGCGTTTATATAAACCGTGAAATAGCCGAAAAAC
rJMSF021J21+ TCGAACTCGCTGTGTTATGCGTTTATATAAACCGTGAAATAGCCGAAAAACCATGTACAG
rJMFF043B18+ TCGAACTCGCTGTGTTATGCGTTTATATAAA-CGTGAAATAGCCGAAAAA-CATGTACAG
rJMFF051I16+ TCGAACTCGCTGTGTTATGCGTTTATATAAA-CGTGAAATAGCCGAAAAA-CATGTACAG
rJMFF051K16+ TCGAACTCGCTGTGTTATGCGTTTATATAAA-CGTGAAATAGCCGAAAAA-CATGTACAG
rJMFF051C18+ TCGAACTCGCTGTGTTATGCGTTTATATAAA-CGTGAAATAGCCGAAAAA-CATGTACAG
                      ____________________________________________________________
consensus TCGAACTCGCTGTGTTATGCGTTTATATAAA-CGTGAAATAGCCGAAAAA-CATGTACAG
 
. : . : . : . : . : . :
rJMSF021J21+ AAT
rJMFF043B18+ AATTATCTGGTTCTTCACGAAATATCATCATTTTGAT
rJMFF051I16+ AATTATCTGGTTCTTCACGAAATATCATCATTTTGATAGATCAGGCTGGTTTTGACATGG
rJMFF051K16+ AATTATCTGGTTCTTCACGAAATATCATCATTTTGATAGATCAGGCTGGTTTTGACATGG
rJMFF051C18+ AATTATCTGGTTCTTCACGAAATATCATCATTTTGATAGATCAGGCTGGTTTTGACATGG
                      ____________________________________________________________
consensus AATTATCTGGTTCTTCACGAAATATCATCATTTTGATAGATCAGGCTGGTTTTGACATGG
 
. : . : . : . : . : . :
rJMFF051I16+ CGTCAACCGGTTTNAAATAGAAAAAAAAAAAAAAACTCTCCAGGGT
rJMFF051K16+ CGTCAACCGGTTT
rJMFF051C18+ CGTCAACCGGTTT-AAATAGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus CGTCAACCGGTTTNAAATAGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG