Previous Contig 011056:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B15Sequence573011056 (4)gb:AP002048_18216630.004Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.672011056 (4)gb:AY563141_16150120.037Medicago sativa calcium/calmodulin-regulated receptor-like kinase mRNA, complete
JMFF051C13Sequence627005983 (2)gb:AP003279_18271103e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P052556011056 (4)gb:AY563141_16150122e-32Medicago sativa calcium/calmodulin-regulated receptor-like kinase mRNA, complete
JMFS018F10Sequence601011056 (4)gb:AP002048_18216630.005Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS018F10- ACATTCACGCCTAACCCACATCAGACTTCACCATTTTCAAC
JMFF003B15- ATTTTCAAC
                      ____________________________________________________________
consensus ACATTCACGCCTAACCCACATCAGACTTCACCATTTTCAAC
 
. : . : . : . : . : . :
JMFS018F10- ATTCTCTCTCTATCTCTCTGTCGCCCATCTCTCTATCTATTACCATGGCGTGAGTCTTGC
JMFF003B15- ATTCTCTCTCTATCTCTCTGTCGCCCATCTCTCTATCTATTACCATGGCGTGAGTCTTGC
rJMFF003B15+ CCATGGCGTGAGTCTTGC
                      ____________________________________________________________
consensus ATTCTCTCTCTATCTCTCTGTCGCCCATCTCTCTATCTATTACCATGGCGTGAGTCTTGC
 
. : . : . : . : . : . :
JMFS018F10- TTTCCTAACATCAAAACATCACAAATCTTTGCTTCTTCAGCGATTCATTTGCTCCATCGC
JMFF003B15- TTTCCTAACATCAAAACATCACAAATCTTTGCTTCTTCAGCGATTCATTTGCTCCATCGC
rJMFF003B15+ TTTCCTAACATCAAAACATCACAAATCTTTGCTTNTTCAGCGATTCATTTGCTCCATCGC
                      ____________________________________________________________
consensus TTTCCTAACATCAAAACATCACAAATCTTTGCTTCTTCAGCGATTCATTTGCTCCATCGC
 
. : . : . : . : . : . :
JMFS018F10- TAAAAAGGCACTCCTCAGATCCATCTGCGATTTCTTCCGCCAGCTTCCATTTCAGTGATT
JMFF003B15- TAAAAAGGCACTCCTCAGATCCATCTGCGATTTCTTCCGCCAGCTTCCATTTCAGTGATT
rJMFF003B15+ TAAAAAGGCACTCCTCAGATCCATTTGCGATTTNTTCCGCCAGCTTCCATTTCAGTGATT
                      ____________________________________________________________
consensus TAAAAAGGCACTCCTCAGATCCATCTGCGATTTCTTCCGCCAGCTTCCATTTCAGTGATT
 
. : . : . : . : . : . :
JMFS018F10- CATTCTCCATTTCTTCCGCCAGCTTCCATTTCAACGATTCATTCTCCATTTCTTCCACCA
JMFF003B15- CATTCTCCATTTCTTCCGCCAGCTTCCATTTCAACGATTCATTCTCCATTTCTTCCACCA
rJMFF003B15+ CATTNTCCATTTNTTCCGCCAGCTTCCATTTCAACGATTCATTNTCCATTTNTTCCNCCA
                      ____________________________________________________________
consensus CATTCTCCATTTCTTCCGCCAGCTTCCATTTCAACGATTCATTCTCCATTTCTTCCACCA
 
. : . : . : . : . : . :
JMFS018F10- GCTGCTGTACTACCGCGACGAATTCGGCGACCGCGCTTACATCTCCGGTCGATCCGCAAC
JMFF003B15- GCTGCTGTACTACCGCGACGAATTCGGCGACCGCGCTTACATCTCCGGTCGATCCGCAAC
rJMFF003B15+ GCTGCTGTACTACCGCGACGAATTCGGCGACCGCGCTTACATNTCCGGTCGATCCGCAAC
                      ____________________________________________________________
consensus GCTGCTGTACTACCGCGACGAATTCGGCGACCGCGCTTACATCTCCGGTCGATCCGCAAC
 
. : . : . : . : . : . :
JMFS018F10- GCTTACATCGCTATCCAGGCCTGGAAGCAGGCCATCTCAGATCCGGTGGCAGAAATCCAG
JMFF003B15- GCTTACATCGCTATCCAGGCCTGGAAGCAGGCCATCTCAGATCCGGTGGCAGAAATCCAG
rJMFF003B15+ GCTTACATCGCTATCCAGGCCNGGAAGCAGGCCATNTCAGATCCGGTGGCAGAAATCCAG
                      ____________________________________________________________
consensus GCTTACATCGCTATCCAGGCCTGGAAGCAGGCCATCTCAGATCCGGTGGCAGAAATCCAG
 
. : . : . : . : . : . :
JMFS018F10- ATCCGGTGGCGGAGTGCTCAGATCTGGTGGCAGAGAGCTCACGGAGGATGGTCGCCGGCT
JMFF003B15- ATCCGGTGGCGGAGTGCTCAGATCTGGTGGCAGAGAGCTCACGGAGGATGGTCGCCGGCT
rJMFF003B15+ ATCCGGTGGCGGAGTGCTCAGATNTGGTGGCAGAGAGCTCACGGAGGATGGTCGCCGGCT
                      ____________________________________________________________
consensus ATCCGGTGGCGGAGTGCTCAGATCTGGTGGCAGAGAGCTCACGGAGGATGGTCGCCGGCT
 
. : . : . : . : . : . :
JMFS018F10- TCTCTTCCATTTCCGATGCACAGAGCTCAGGATGGGTTGAAGATACTGAAAAGAGGAGAT
JMFF003B15- TCTCTTCCATTTCCGATGCACAGAGCTCAGGATGGGTTGAAGATACTGAAAAGAGGAGAT
rJMFF003B15+ TNTNTTCCATTTCCGATGCACAGAGCTCAGGATGGGTTGAAGATACTGAAAAGAGGAGAT
rJMFF051C13+ GTTGAAGATACTGAAAAGAGGAGAT
                      ____________________________________________________________
consensus TCTCTTCCATTTCCGATGCACAGAGCTCAGGATGGGTTGAAGATACTGAAAAGAGGAGAT
 
. : . : . : . : . : . :
JMFS018F10- ACTATAATGGCTATGGATCCAAGATTACAAAGAAGTCCAGCTTCCGTTGAGGC
JMFF003B15- ACTATAATGGCTATGGATCCAAGATTACAAAGAAGTCCAGCTTCCGTTGAGGC
rJMFF003B15+ ACTATAATGGCTATGGATCCAAGATTACAAAGAAGTCCAGCTTCCGTTGAGGC
rJMFF051C13+ ACTGTAATGGCTATGGATCCAAGATTACGAAGAAGTCCAGCTTCCGTTGAGGCAGTGGAG
                      ____________________________________________________________
consensus ACTATAATGGCTATGGATCCAAGATTACAAAGAAGTCCAGCTTCCGTTGAGGCAGTGGAG
 
. : . : . : . : . : . :
rJMFF051C13+ AAGGTACTTAAAGTGGCACATCTATGTGTTGCGCCTTCAAGATCGGGAAGGCCATCCATG
                      ____________________________________________________________
consensus AAGGTACTTAAAGTGGCACATCTATGTGTTGCGCCTTCAAGATCGGGAAGGCCATCCATG
 
. : . : . : . : . : . :
rJMFF051C13+ AGAAAATGTGCAGAGGTGCTATGGAGAGTTAGGAAAGAATTCAGAGATCGAAGTGTACAT
                      ____________________________________________________________
consensus AGAAAATGTGCAGAGGTGCTATGGAGAGTTAGGAAAGAATTCAGAGATCGAAGTGTACAT
 
. : . : . : . : . : . :
rJMFF051C13+ TCCAGTGCTGCTGCTTCTGCATCTTACTACACAGCTTTTGTAGGGAAAAATTCCCCCACG
                      ____________________________________________________________
consensus TCCAGTGCTGCTGCTTCTGCATCTTACTACACAGCTTTTGTAGGGAAAAATTCCCCCACG
 
. : . : . : . : . : . :
rJMFF051C13+ CCCAGTGTTGATTTTAGCGATAAACTTAAGTTTGCTTCTGCTTAAACAACCCTCATTATT
                      ____________________________________________________________
consensus CCCAGTGTTGATTTTAGCGATAAACTTAAGTTTGCTTCTGCTTAAACAACCCTCATTATT
 
. : . : . : . : . : . :
rJMFF051C13+ TGTTTGTACTGAAAACACTTGTAAGAAAAGGCTATGCCAACAACACACAAAAATACTAAA
                      ____________________________________________________________
consensus TGTTTGTACTGAAAACACTTGTAAGAAAAGGCTATGCCAACAACACACAAAAATACTAAA
 
. : . : . : . : . : . :
rJMFF051C13+ TAAAATAATTATTGAGGACAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TAAAATAATTATTGAGGACAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG