Previous Contig 011053:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033F11Sequence553011053 (8)gb:AY039558_15602711e-52Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A482011053 (8)gb:AY039558_15602714e-14Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A
JMFF051C04Sequence609011053 (8)gb:AY039558_15602711e-51Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A471011053 (8)gb:AP003727_18325443e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF023P03Sequence631011053 (8)gb:AY039558_15602716e-52Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A744011053 (8)gb:AY039558_15602711e-49Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A
JMSF031M02Sequence592011053 (8)gb:AY039558_15602711e-46Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A672011053 (8)gb:AY039558_15602712e-37Arabidopsis thaliana AT5g14030/MUA22_2 mRNA, complete cds.>gb:AY085620_1570688 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031M02- GTCAAACCTC
JMFF051C04- ATTCTGTCAAACCTC
JMFF033F11- ATTCTGTCAAACCTC
JMSF023P03- GAAGACTTATTCTGTCAAACCTC
                      ____________________________________________________________
consensus GAAGACTTATTCTGTCAAACCTC
 
. : . : . : . : . : . :
JMSF031M02- GCACTCTCTCTCATTACCACGTCTACTCTGAATCTGAGCTATGGCGAATTGGTCGAGGAA
JMFF051C04- GCACTCTCTCTCATTACCACGTCTACTCTGAATCTGAGCTATGGCGAATTGGTCGAGGAA
JMFF033F11- GCACTCTCTCTCATTACCACGTCTACTCTGAATCTGAGCTATGGCGAATTGGTCGAGGGA
JMSF023P03- GCACTCTCTCTCATTACCACGTCTACTCTGAATCTGAGCTATGGCGAATTGGTCGAGGAA
                      ____________________________________________________________
consensus GCACTCTCTCTCATTACCACGTCTACTCTGAATCTGAGCTATGGCGAATTGGTCGAGGAA
 
. : . : . : . : . : . :
JMSF031M02- CTCTTCCCTACCTCTTCTCTTCTTCTTCTTGGTGTCATGGACTGCAGTCGCGGCCAGTTC
JMFF051C04- CTCTTCCCTACCTCTTCTCTTCTTCTTCTTGGTGTCATGGACTGCAGTCGCGGCCAGTTC
JMFF033F11- CTCTTCCCTACCTCTTCTCTTCTTCTTCTTGGTGTCATGGACTGCAGTCGCGGCCAGTTC
JMSF023P03- CTCTTCCCTACCTCTTCTCTTCTTCTTCTTGGTGTCATGGACTGCAGTCGCGGCCAGTTC
                      ____________________________________________________________
consensus CTCTTCCCTACCTCTTCTCTTCTTCTTCTTGGTGTCATGGACTGCAGTCGCGGCCAGTTC
 
. : . : . : . : . : . :
JMSF031M02- CGATGGCCCCTTCATCATCGCCCACAAGAAGGCCACCACTACCAGGCTGAAATCCGGTTC
JMFF051C04- CGATGGCCCCTTCATCATCGCCCACAAGAAGGCCACCACTACCAGGCTGAAATCCGGTTC
JMFF033F11- CGATGGCCCCTTCATCATCGCCCACAAGAAGGCCACCACTACCAGGCTGAAATCCGGTTC
JMSF023P03- CGATGGCCCCTTCATCATCGCCCACAAGAAGGCCACCACTACCAGGCTGAAATCCGGTTC
rJMSF023P03+ CCCACAAGAAGGCCACCACTACCAGGCTGAAATCCGGTTC
                      ____________________________________________________________
consensus CGATGGCCCCTTCATCATCGCCCACAAGAAGGCCACCACTACCAGGCTGAAATCCGGTTC
 
. : . : . : . : . : . :
JMSF031M02- CGAACGTGTCTCTGTCACCATCGACCTCTATAACGAAGGATCTGCGACTGCTTATGATTT
JMFF051C04- CGAACGTGTCTCTGTCACCATCGACCTCTATAACGAAGGATCTGCGACTGCTTATGATTT
JMFF033F11- CGAACGTGTCTCTGTCACCATCGACCTCTATAACGAAGGATCTGCGACTGCTTATGATTT
JMSF023P03- CGAACGTGTCTCTGTCACCATCGACCTCTATAACGAAGGATCTGCGACTGCTTATGATTT
rJMSF023P03+ CGAACGTGTCTCTGTCACCATCGACCTCTATAACGAAGGATCTGCGACTGCTTATGATTT
rJMSF031M02+ GCGACTGCTTATGATTT
                      ____________________________________________________________
consensus CGAACGTGTCTCTGTCACCATCGACCTCTATAACGAAGGATCTGCGACTGCTTATGATTT
 
. : . : . : . : . : . :
JMSF031M02- GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
JMFF051C04- GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
JMFF033F11- GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
JMSF023P03- GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
rJMSF023P03+ GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
rJMSF031M02+ GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
                      ____________________________________________________________
consensus GAGTCTTAACGATGATACCTGGCCCAAGAATATATTTGACATTGTCACTGGTAACACTTC
 
. : . : . : . : . : . :
JMSF031M02- TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
JMFF051C04- TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
JMFF033F11- TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
JMSF023P03- TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
rJMFF033F11+ TATGTCATGGGATCGGCNTGATGTAGGNGGTGCTNTNTCACATNCCTCNGAANNGGAGGC
rJMSF023P03+ TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
rJMSF031M02+ TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
                      ____________________________________________________________
consensus TATGTCATGGGATCGGCTTGATGTAGGTGGTGCTCTATCACATTCCTTTGAATTGGAGGC
 
. : . : . : . : . : . :
JMSF031M02- CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
JMFF051C04- CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
JMFF033F11- CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
JMSF023P03- CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
rJMFF033F11+ CAAAGNTAANACATCGTTNTATGGTGTACCAGCAGTCATAACCTNTNGTGTCCCCACCAA
rJMSF023P03+ CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
rJMSF031M02+ CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
                      ____________________________________________________________
consensus CAAAGCTAAAACATTGTTTTATGGTGTACCAGCAGTCATAACCTTTCGTGTCCCCACCAA
 
. : . : . : . : . : . :
JMSF031M02- GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTANCANAGAG
JMFF051C04- GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
JMFF033F11- GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
JMSF023P03- GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
rJMFF033F11+ GGNTGCTNTNCAGGAGGNNTACTNTNCTCCGATNNTGCCTCTTGACTTANTAGCAGAGAG
rJMSF023P03+ GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
rJMSF031M02+ GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
rJMFF051C04+ GCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
                      ____________________________________________________________
consensus GGCTGCTCTGCAGGAGGCTTACTCTACTCCGATCTTGCCTCTTGACTTACTAGCAGAGAG
 
. : . : . : . : . : . :
JMSF031M02- ACCTACTGAGAAGAAGTTTGACTTGGCCAANANACTTTTGGCAAAATATGGCTCCTTGGT
JMFF051C04- ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTGGT
JMFF033F11- ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTG
JMSF023P03- ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTGGT
rJMFF033F11+ NCNTCCTGAGAAGAAGTNNGACTTGGCCAAGAGNCTTNTGGCAAAATANGNCTCCTCGGT
rJMSF023P03+ ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTGGT
rJMSF031M02+ ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTGGT
rJMFF051C04+ ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTGGT
                      ____________________________________________________________
consensus ACCTACTGAGAAGAAGTTTGACTTGGCCAAGAGACTTTTGGCAAAATATGGCTCCTTGGT
 
. : . : . : . : . : . :
JMSF031M02- TTCTGTGATATCCATTG
JMFF051C04- TTCTGTGATATCCATTGTGGTTCTGTTTATTTACCTGATTTGCACCCCATCAAA
JMSF023P03- TTCTGTGATATCCATTGTGGTTCTGTTTATTTACCTGATTGCAACCCCATCAAAATCCGG
rJMFF033F11+ TTCTGTGATATCCATCGTGGTTNTGTTTATTNACNTNATNGCANCCCCATCAAAATCCGG
rJMSF023P03+ TTCTGTGATATCCATTGTGGTTCTGTTTATTTACCTGATTGCAACCCCATCAAAATCCGG
rJMSF031M02+ TTCTGTGATATCCATTGTGGTTCTGTTTATTTACCTGATTGCAACCCCATCAAAATCCGG
rJMFF051C04+ TTCTGTGATATCCATTGTGGTTCTGTTTATTTACCTGATTGCAACCCCATCAAAATCCGG
                      ____________________________________________________________
consensus TTCTGTGATATCCATTGTGGTTCTGTTTATTTACCTGATTGCAACCCCATCAAAATCCGG
 
. : . : . : . : . : . :
JMSF023P03- TGCTGCAA
rJMFF033F11+ TGNTGCAAAGAAGAAGCNGTAAATGTATGGTGNTGGTNGCTGCTCAANTNTTGGGTCAGN
rJMSF023P03+ TGCTGCAAAGAAGAAGCGCTAAATGTATGGTGCTGGTTGCTGCTCAATTTTTGGGTCAGG
rJMSF031M02+ TGCTGCAAAGAAGAAGCGCTAAATGTATGGTGCTGGTTGCTGCTCAATTTTTGGGTCAGG
rJMFF051C04+ TGCTGCAAAGAAGAAGCGCTAAATGTATGGTGCTGGTTGCTGCTCAATTTTTGGGTCAGG
                      ____________________________________________________________
consensus TGCTGCAAAGAAGAAGCGCTAAATGTATGGTGCTGGTTGCTGCTCAATTTTTGGGTCAGG
 
. : . : . : . : . : . :
rJMFF033F11+ GAAGAGTATNCCAAAAAACACNCNTTGGTCATCNGGAATANGNTGTCNTTATTGTCNTTC
rJMSF023P03+ GAAGAGTCTACCAAAAAACACACTTTGGTCATCCGGAATATGCTGTCTTTATTGTCTTTC
rJMSF031M02+ GAAGAGTCTACCAAAAAACACACTTTGGTCATCCGGAATATGCTGTCTTTATTGTCTTTC
rJMFF051C04+ GAAGAGTCTACCAAAAAACACACTTTGGTCATCCGGAATATGCTGTCTTTATTGTCTTTC
                      ____________________________________________________________
consensus GAAGAGTCTACCAAAAAACACACTTTGGTCATCCGGAATATGCTGTCTTTATTGTCTTTC
 
. : . : . : . : . : . :
rJMFF033F11+ AGNCATAGAGGTCATCGTAATTCATCAG
rJMSF023P03+ AGTCATAGAGGTCATTGTAATTCATCAGTTCAGTTTTTAATTTTATAGAACAATTAAAGC
rJMSF031M02+ AGTCATAGAGGTCATTGTAATTCATCAGTTCAGTTTTTAATTTTATAGAACAATTAAAGC
rJMFF051C04+ AGTCATAGAGGTCATTGTAATTCATCAGTTCAGTTTTTAATTTTATAGAACAATTAAAGC
                      ____________________________________________________________
consensus AGTCATAGAGGTCATTGTAATTCATCAGTTCAGTTTTTAATTTTATAGAACAATTAAAGC
 
. : . : . : . : . : . :
rJMSF023P03+ AGTTTGACAGTAGACTAGCTTGCTTTCTCACTCCAGCCCATTCCCATCCAATGCGGCAGT
rJMSF031M02+ AGTTTGACAGTAGACTAGCTTGCTTTCTCACTCCAGCCCATTCCCATCCAATGCGGCAGT
rJMFF051C04+ AGTTTGACAGTAGACTAGCTTGCTTTCTCACTCCAGCCCATTCCCATCCAATGCGGCAGT
                      ____________________________________________________________
consensus AGTTTGACAGTAGACTAGCTTGCTTTCTCACTCCAGCCCATTCCCATCCAATGCGGCAGT
 
. : . : . : . : . : . :
rJMSF023P03+ ATCATATTAGAGAACTAGAGTTTGGTGTTTGTGCCTCAAATGCT
rJMSF031M02+ ATCATATTAGAGAACTAGAGTTTGGTGTTTGTGCCTCAAATGCTACATTTT
rJMFF051C04+ ATCATATTAGAGAACTAGAGTTTGGTGTTTGTGCCTCAAATGCTACATTTTTCTTTTTCC
                      ____________________________________________________________
consensus ATCATATTAGAGAACTAGAGTTTGGTGTTTGTGCCTCAAATGCTACATTTTTCTTTTTCC