Previous Contig 011046:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028I09Sequence589001323 (2)gb:AY091691_15747021e-34Arabidopsis thaliana AT3g13930/MDC16_5 mRNA, complete cds.>gb:BT000444_1634722 A722011046 (3)gb:BT020419_16428142e-64Arabidopsis thaliana At1g54220 mRNA, complete cds.
JMFF051A07Sequence592001323 (2)gb:AY091691_15747023e-35Arabidopsis thaliana AT3g13930/MDC16_5 mRNA, complete cds.>gb:BT000444_1634722 A592011046 (3)gb:BT020419_16428146e-34Arabidopsis thaliana At1g54220 mRNA, complete cds.
JMFN019E22Sequence685011046 (3)gb:AY092968_15749222e-63Arabidopsis thaliana dihydrolipoamide acetyltransferase (At3g13930) mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN019E22- GCAGACGGACAACGGCCTCTATGTACCTGTTGTCAG
rJMFF028I09+ TCAACGTTGCTGTGCAGACGGACAACGGCNTCTATGTACCTGTTGTCAG
                      ____________________________________________________________
consensus TCAACGTTGCTGTGCAGACGGACAACGGCCTCTATGTACCTGTTGTCAG
 
. : . : . : . : . : . :
JMFN019E22- GGATGCTGATAAGAAGGGTTTGTCCACTATTGCAGAAGAAGTGAAGTATTTAGCACAAAA
rJMFF028I09+ GGATGCTGATAAGAAGGGTTTGTCCACTATTGCAGAAGAAGTGAAGTATTTAGCACAAAA
                      ____________________________________________________________
consensus GGATGCTGATAAGAAGGGTTTGTCCACTATTGCAGAAGAAGTGAAGTATTTAGCACAAAA
 
. : . : . : . : . : . :
JMFN019E22- AGCAAAAGAAAATAGCTTAAAGCCATCTGATTATGAGGGAGGCACATTCACAGTGTCAAA
rJMFF028I09+ AGCAAAAGAAAATAGCTTAAAGCCATCTGATTATGAGGGAGGCACATTCACAGTGTCAAA
                      ____________________________________________________________
consensus AGCAAAAGAAAATAGCTTAAAGCCATCTGATTATGAGGGAGGCACATTCACAGTGTCAAA
 
. : . : . : . : . : . :
JMFN019E22- TTTAGGAGGGCCATTTGGTGTTAAACAATTTTGTGCAATTGTTAATCCTCCTCAGGCGGC
rJMFF028I09+ TTTAGGAGGGCCATTTGGTGTTAAACAATTTTGTGCAATTGTTAATCCTCCTCAGGCGGC
rJMFF051A07+ GGCCATTTGGTGTTAAACAATTTTGTGCAATTGTTAATCCTCCTCAGGCGGC
                      ____________________________________________________________
consensus TTTAGGAGGGCCATTTGGTGTTAAACAATTTTGTGCAATTGTTAATCCTCCTCAGGCGGC
 
. : . : . : . : . : . :
JMFN019E22- CATTCTGGCAATCGGATCTGCTGAGAGAAGGGTTGTACCTGGTTCTGGTGCTGACCAGTA
rJMFF028I09+ CATTCTGGCAATCGGATCTGCTGAGAGAAGGGTTGTACCTGGTTCTGGTGCTGACCAGTA
rJMFF051A07+ CATTCTGGCAATCGGATCTGCTGAGAGAAGGGTTGTACCTGGTTCTGGTGCTGACCAGTA
                      ____________________________________________________________
consensus CATTCTGGCAATCGGATCTGCTGAGAGAAGGGTTGTACCTGGTTCTGGTGCTGACCAGTA
 
. : . : . : . : . : . :
JMFN019E22- TAAGTTTGCCTCTTTGATGTCTGCGACATTGAGTTGTGATCACCGGGTTATTGATGGTGC
rJMFF028I09+ TAAGTTTGCCTCTTTGATGTCTGCGACATTGAGTTGTGATCACCGGGTTATTGATGGTGC
rJMFF051A07+ TAAGTTTGCCTCTTTGATGTCTGCGACATTGAGTTGTGATCACCGGGTTATTGATGGTGC
                      ____________________________________________________________
consensus TAAGTTTGCCTCTTTGATGTCTGCGACATTGAGTTGTGATCACCGGGTTATTGATGGTGC
 
. : . : . : . : . : . :
JMFN019E22- AATTGGTGCAGAATGGCTTAAAGCATTTAAAGGCTACATTGAGAATCCCGAATCTATGTT
rJMFF028I09+ AATTGGTGCAGAATGGCTTAAAGCATTTAAAGGCTACATTGAGAATCCCAAATCTATGTT
rJMFF051A07+ AATTGGTGCAGAATGGCTTAAAGCATTTAAAGGCTACATTGAGAATCCCAAATCTATGTT
                      ____________________________________________________________
consensus AATTGGTGCAGAATGGCTTAAAGCATTTAAAGGCTACATTGAGAATCCCAAATCTATGTT
 
. : . : . : . : . : . :
JMFN019E22- GCTGTAGATTGATATTTACTGTTTCTGCTCATTTCTGTTTTTGGCCTTTGCATGATCAAG
rJMFF028I09+ GCTGTAGATTGATATTTACTGTTTCTGCTCATTTCTGTTTTTGGCCTTTGCATGATCAAG
rJMFF051A07+ GCTGTAGATTGATATTTACTGTTTCTGCTCATTTCTGTTTTTGGCCTTTGCATGATCAAG
                      ____________________________________________________________
consensus GCTGTAGATTGATATTTACTGTTTCTGCTCATTTCTGTTTTTGGCCTTTGCATGATCAAG
 
. : . : . : . : . : . :
JMFN019E22- CTAAAAAGCAAATTATCAGCAACGGCAAGTTGATGATTTCATTTGTTGGCTTGATTTTGT
rJMFF028I09+ CTAAAAAGCAAATTATCAGCAACGGCAAGTTGATGATTTCATTTGTTGGCTTGATTTTGT
rJMFF051A07+ CTAAAAAGCAAATTATCAGCAACGGCAAGTTGATGATTTCATTTGTTGGCTTGATTTTGT
                      ____________________________________________________________
consensus CTAAAAAGCAAATTATCAGCAACGGCAAGTTGATGATTTCATTTGTTGGCTTGATTTTGT
 
. : . : . : . : . : . :
JMFN019E22- AGCTTTTATAGAGCCCCCTCACCAAGAAAATGGCTGAATTGATGATGTCAAATAACGGGG
rJMFF028I09+ AGCTTTTATAGAGCCCCCTCACCAAGAAAATGGCTGAATTGATGATGTCAAATAACGGGG
rJMFF051A07+ AGCTTTTATAGAGCCCCCTCACCAAGAAAATGGCTGAATTGATGATGTCAAATAACGGGG
                      ____________________________________________________________
consensus AGCTTTTATAGAGCCCCCTCACCAAGAAAATGGCTGAATTGATGATGTCAAATAACGGGG
 
. : . : . : . : . : . :
JMFN019E22- TCTGAGGATGGAAACCCCACATGCTTTTGGATTNTGTAGGATGTAGGGACATTNTTTTGT
rJMFF028I09+ TCTGAGGATGGAAACCCCACATGCTTTTGGATTTTGTAGGATGTAGGGACATTTTTTTGT
rJMFF051A07+ TCTGAGGATGGAAACCCCACATGCTTTTGGATTTTGTAGGATGTAGGGACATTTTTTTGT
                      ____________________________________________________________
consensus TCTGAGGATGGAAACCCCACATGCTTTTGGATTTTGTAGGATGTAGGGACATTTTTTTGT
 
. : . : . : . : . : . :
JMFN019E22- GACCTAGAATTGAGTTACCAATTGTCGTTTTATACTGGATGTACC
rJMFF028I09+ GACCTAGAATTGAGTTACCAATTGTCGTTTTATACTGGATGTACCTCATTGGGAAGACTA
rJMFF051A07+ GACCTAGAATTGAGTTACCAATTGTCGTTTTATACTGGATGTACCTCATTGGGAAGACTA
                      ____________________________________________________________
consensus GACCTAGAATTGAGTTACCAATTGTCGTTTTATACTGGATGTACCTCATTGGGAAGACTA
 
. : . : . : . : . : . :
rJMFF028I09+ TATATTT
rJMFF051A07+ TATATTTTCATCATGCAATAAGAGAAGCAGTTCTACAAAAAAAAAAAAAAAACTCTCCAG
                      ____________________________________________________________
consensus TATATTTTCATCATGCAATAAGAGAAGCAGTTCTACAAAAAAAAAAAAAAAACTCTCCAG