Previous Contig 011037:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050N24Sequence606012060 (6)gb:AY635910_16188221e-56Lotus corniculatus var. japonicus digalactosyldiacylglycerol synthase 2 (DGD2) m627011037 (3)gb:AY635910_16188221e-07Lotus corniculatus var. japonicus digalactosyldiacylglycerol synthase 2 (DGD2) m
JMSF007I14Sequence476012060 (6)pir|T50833|T508331e-33nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16745011037 (3)pir|T01219|T012192e-46hypothetical protein F6N23.24 - Arabidopsis thaliana>gb:ATCHRIV2_1544473 Arabido
JMSF009P24Sequence303012060 (6)721011037 (3)gb:AF421194_17988545e-42Arabidopsis thaliana clone 4-4-1 digalactosyldiacylglycerol synthase (DGD2) mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007I14+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
rJMSF009P24+ AAGCACAACAGACGTCGTATGTACAACCACAGCAGAA
rJMSF007I14+ GACTATAAAGTGCTCCTGAATCCAAGCACAACAGACGTCGTATGTACAACCACAGCAGAA
                      ____________________________________________________________
consensus GACTATAAAGTGCTCCTGAATCCAAGCACAACAGACGTCGTATGTACAACCACAGCAGAA
 
. : . : . : . : . : . :
rJMSF009P24+ GCATTAGCGATGGGCAAAATCGTAGTATGTGCCAATCATCCCTCGAACGAATTCTTTATG
rJMSF007I14+ GCATTAGCGATGGGCAAAATCGTAGTATGTGCCAATCATCCCTCGAACGAATTCTTTATG
                      ____________________________________________________________
consensus GCATTAGCGATGGGCAAAATCGTAGTATGTGCCAATCATCCCTCGAACGAATTCTTTATG
 
. : . : . : . : . : . :
rJMSF009P24+ CAGTTCCCAAACTGCCGCACATACGATGATGGCAACGGTTTTGTTAAAGCTACCCGGGAG
rJMSF007I14+ CAGTTCCCAAACTGCCGCACATACGATGATGGCAACGGTTTTGTTAAAGCTACCCGGGAG
                      ____________________________________________________________
consensus CAGTTCCCAAACTGCCGCACATACGATGATGGCAACGGTTTTGTTAAAGCTACCCGGGAG
 
. : . : . : . : . : . :
rJMSF009P24+ GCACTGTCCGAGCAACCTGCTCCCCTGAGCGATGAGCAAAGGCACGAGCTTTCGTGGGAG
rJMSF007I14+ GCACTGTCCGAGCAACCTGCTCCCCTGAGCGATGAGCAAAGGCACGAGCTTTCGTGGGAG
rJMFF050N24+ ATGAGCAAAGGCACGAGCTTTCGTGGGAG
                      ____________________________________________________________
consensus GCACTGTCCGAGCAACCTGCTCCCCTGAGCGATGAGCAAAGGCACGAGCTTTCGTGGGAG
 
. : . : . : . : . : . :
rJMSF009P24+ GCAGCAACCGAGAGGTTTTTGAAAGCAGCCGAGCTGGAGAACATTCCAAAGCGGAAACTG
rJMSF007I14+ GCAGCAACCGAGAGGTTTTTGAAAGCAGCCGAGCTGGAGAACATTCCAAAGCGGAAACTG
rJMFF050N24+ GCAGCAACCGAGAGG-TTTTGAAAGCAGCCGAGCTGGAGAACATTCCAAAGCGGAAACTG
                      ____________________________________________________________
consensus GCAGCAACCGAGAGGTTTTTGAAAGCAGCCGAGCTGGAGAACATTCCAAAGCGGAAACTG
 
. : . : . : . : . : . :
rJMSF009P24+ TCAATGAAGAAGAGCTCAAAGCCTACTCTCTCCACATCCATTAGCCTAAAAGACATTAAT
rJMSF007I14+ TCAATGAAGAAGAGCTCAAAGCCTACTCTCTCCACATCCATTAGCCTAAAAGACATTAAT
rJMFF050N24+ TCAATGAAGAAGAGCTCAAAGCCTACTCTCTCCACATCCATTAGCCTAAAAGACATTAAT
                      ____________________________________________________________
consensus TCAATGAAGAAGAGCTCAAAGCCTACTCTCTCCACATCCATTAGCCTAAAAGACATTAAT
 
. : . : . : . : . : . :
rJMSF009P24+ CTTGAAGATGCATCTGCATTCATACACAATGTGGGAACTGGGTTTCTGAATTCGCCACCA
rJMSF007I14+ CTTGAAGATGCATCTGCATTCATACACAATGTGGGAACTGGGTTTCTGAATTCGCCACCA
rJMFF050N24+ CTTGAAGATGCATCTGCATTCATACACAATGTGGGAACTGGGTTTCTGAATTCGCCACCA
                      ____________________________________________________________
consensus CTTGAAGATGCATCTGCATTCATACACAATGTGGGAACTGGGTTTCTGAATTCGCCACCA
 
. : . : . : . : . : . :
rJMSF009P24+ AACGAAGAGCAATGTAAAGAGCTCGGCCTCGCTTTACCTTCCAAGAAAAAGGGATCTTCT
rJMSF007I14+ AACGAAGAGCAATGTAAAGAGCTCGGCCTCGCTTTACCTTCCAAGAAAAAGGGATCTTCT
rJMFF050N24+ AACGAAGAGCAATGTAAAGAGCTCGGCCTCGCTTTACCTTCCAAGAAAAAGGGATCTTCT
                      ____________________________________________________________
consensus AACGAAGAGCAATGTAAAGAGCTCGGCCTCGCTTTACCTTCCAAGAAAAAGGGATCTTCT
 
. : . : . : . : . : . :
rJMSF009P24+ TCTAGTAAACGGATATGAGAATCATGGTCAAGTCACACTAACACAATCTTCAAATGAATT
rJMSF007I14+ TCTAGTAAACGGATATGAGAATCATGGTCAAGTCACACTAACACAATCTTCAAATGAATT
rJMFF050N24+ TCTAGTAAACGGATATGAGAATCATGGTCAAGTCACACTAACACAATCTTCAAATGAATT
                      ____________________________________________________________
consensus TCTAGTAAACGGATATGAGAATCATGGTCAAGTCACACTAACACAATCTTCAAATGAATT
 
. : . : . : . : . : . :
rJMSF009P24+ GGACCTAACGTCAAGGCGGGGAGGGGGCATGCAGTGTTAATGTTTATTGCCATCTTTTCA
rJMSF007I14+ GGACCTAACGTCAAGGCGGGGAGGGGGCATGCAGTGTTAATGTTTATTGCCATCTTTTCA
rJMFF050N24+ GGACCTAACGTCAAGGCGGGGAGGGGGCATGCAGTGTTAATGTTTATTGCCATCTTTTCA
                      ____________________________________________________________
consensus GGACCTAACGTCAAGGCGGGGAGGGGGCATGCAGTGTTAATGTTTATTGCCATCTTTTCA
 
. : . : . : . : . : . :
rJMSF009P24+ TTTCTATGGTAACTGATAACCAGGGATTACTTTTGTTGTTCATCTCATGAATAAATCTCA
rJMSF007I14+ TTTCTATGGTAACTGATAACCAGGGATTACTTTTGTTGTTCATCTCATGAATAAATCTCA
rJMFF050N24+ TTTCTATGGTAACTGATAACCAGGGATTACTTTTGTTGTTCATCTCATGAATAAATCTCA
                      ____________________________________________________________
consensus TTTCTATGGTAACTGATAACCAGGGATTACTTTTGTTGTTCATCTCATGAATAAATCTCA
 
. : . : . : . : . : . :
rJMSF009P24+ AATTGGGGGGACCAGGCAAGAATGGTGAAGTGTTAATGTTGTGCAGTCAATGTTACATAC
rJMSF007I14+ AATTGGGGGGACCAGGCAAGAATGGTGAAGTGTTAATGTTGTGCAGTCAATGTTACATAC
rJMFF050N24+ AATTGGGGGGACCAGGCAAGAATGGTGAAGTGTTAATGTTGTGCAGTCAATGTTACATA-
                      ____________________________________________________________
consensus AATTGGGGGGACCAGGCAAGAATGGTGAAGTGTTAATGTTGTGCAGTCAATGTTACATAC
 
. : . : . : . : . : . :
rJMSF009P24+ CATGTATTGTATATTATGCGATTT
rJMSF007I14+ CATGTATTGTATATTATGCGATTT
rJMFF050N24+ CATGTATTGTATATTATGCGATTTTCGCGTGTGTATACAGTATATATATATACACACTAT
                      ____________________________________________________________
consensus CATGTATTGTATATTATGCGATTTTCGCGTGTGTATACAGTATATATATATACACACTAT
 
. : . : . : . : . : . :
rJMFF050N24+ TAAGGCTATTTTTCTATGTGTGTTTATAAAACCAAAAGAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TAAGGCTATTTTTCTATGTGTGTTTATAAAACCAAAAGAAAAAAAAAAACTCTCCAGGGT