Previous Contig 011033:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020F24Sequence229003646 (4)299011033 (3)pir|T02504|T025042e-04hypothetical protein At2g38410 [imported] - Arabidopsis thaliana>gb:AC004683_153
JMFF033M17Sequence229003646 (4)298011033 (3)pir|T02504|T025040.004hypothetical protein At2g38410 [imported] - Arabidopsis thaliana>gb:AC004683_153
JMFF050N14Sequence625003646 (4)pir|T02504|T025042e-30hypothetical protein At2g38410 [imported] - Arabidopsis thaliana>gb:AC004683_153602011033 (3)pir|T02504|T025041e-04hypothetical protein At2g38410 [imported] - Arabidopsis thaliana>gb:AC004683_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033M17+ TATACAC
rJMFF020F24+ TGGCTATACAC
                      ____________________________________________________________
consensus TGGCTATACAC
 
. : . : . : . : . : . :
rJMFF033M17+ CACCCTGGGCTCCAACTCCAGGCTATTTCAGCCAATCAAACCAATCATTCCCCCCACTTT
rJMFF020F24+ CACCCTGGGCTCCAACTCCAGGCTATTTCAGCCAATCAAACCAATCATTCCCCCCACTTT
rJMFF050N14+ TTT
                      ____________________________________________________________
consensus CACCCTGGGCTCCAACTCCAGGCTATTTCAGCCAATCAAACCAATCATTCCCCCCACTTT
 
. : . : . : . : . : . :
rJMFF033M17+ ACATGTACTCATCAACCCCACAAACCACCCGCCACGAGCTCATCTTCTCCTCACCTCCCG
rJMFF020F24+ ACATGTACTCATCAACCCCAC-AACCACCCGCCACGAGCTCATCTTCTCCTCACCTCCCG
rJMFF050N14+ ACATGTACTCATCAACCCCAC-AACCACCCGCCACGAGCTCATTTTCTCCTCACCTCCCG
                      ____________________________________________________________
consensus ACATGTACTCATCAACCCCAC-AACCACCCGCCACGAGCTCATCTTCTCCTCACCTCCCG
 
. : . : . : . : . : . :
rJMFF033M17+ GCCAACTCGTTCCCAGCTATGGGAAACAATGGGAATGCACAAGTCAGCGCCACAACGGGT
rJMFF020F24+ GCCAACTCGTTCCCAGCTATGGGAAACAATGGGAATGCACAAGTCAGCGCCACAACGGGT
rJMFF050N14+ GCCAACTCGTTCCCAGCTATGGGAAACAATGGGAATGCACAAGTCAGCGCCACAACGGGT
                      ____________________________________________________________
consensus GCCAACTCGTTCCCAGCTATGGGAAACAATGGGAATGCACAAGTCAGCGCCACAACGGGT
 
. : . : . : . : . : . :
rJMFF033M17+ CTCTCCTCTCCTGAACAGAAGTCTTTCATCCCACCATACAGGCTGTTTGAAGATCTTAAT
rJMFF020F24+ CTCTCCTCTCCTGAACAGAAGTCTTTCATCCCACCATACAGGCTGTTTGAAGATCTTAAT
rJMFF050N14+ CTCTCCTCTCCTGAACAGAAGTCTTTCATCCCACCATACAGGCTGTTTGAAGATCTTAAT
                      ____________________________________________________________
consensus CTCTCCTCTCCTGAACAGAAGTCTTTCATCCCACCATACAGGCTGTTTGAAGATCTTAAT
 
. : . : . : . : . : . :
rJMFF033M17+ GTTTTGGTTAAGGGAGATCATCAGTATCCTAAGGCAACAGGCAACCCA
rJMFF020F24+ GTTTTGGTTAAGGGAGATCATCAGTATCCTAAGGCAACAGGCAACCCA
rJMFF050N14+ GTTTTGGTTAAGGGAGATCATCAGTATCCTAAGACAACAGGCAACCCAGCATACAATTTG
                      ____________________________________________________________
consensus GTTTTGGTTAAGGGAGATCATCAGTATCCTAAGGCAACAGGCAACCCAGCATACAATTTG
 
. : . : . : . : . : . :
rJMFF050N14+ TTTGGAGCAAACAGTCATAATATCATTGATTTGCGCAAATGAGATGATTGATAGGGAATA
                      ____________________________________________________________
consensus TTTGGAGCAAACAGTCATAATATCATTGATTTGCGCAAATGAGATGATTGATAGGGAATA
 
. : . : . : . : . : . :
rJMFF050N14+ TACAACAACATATTACAAGCTTTACATGATCTGCTGGCTGGCCTTTTTCAAGTTTATTTT
                      ____________________________________________________________
consensus TACAACAACATATTACAAGCTTTACATGATCTGCTGGCTGGCCTTTTTCAAGTTTATTTT
 
. : . : . : . : . : . :
rJMFF050N14+ GTAGGTGGAATTTTGGAATAACTATGATTTAGTTGTTATTGTAGCCATGCAATTACTTTG
                      ____________________________________________________________
consensus GTAGGTGGAATTTTGGAATAACTATGATTTAGTTGTTATTGTAGCCATGCAATTACTTTG
 
. : . : . : . : . : . :
rJMFF050N14+ TGTGCAGGCAGCAAGCTAATAGAGATATTTTATGCTTTTTAGGTTTTACTATTCATCAGC
                      ____________________________________________________________
consensus TGTGCAGGCAGCAAGCTAATAGAGATATTTTATGCTTTTTAGGTTTTACTATTCATCAGC
 
. : . : . : . : . : . :
rJMFF050N14+ TATATATTGTACTTTCATTTATTTCTTTTTAAATAATATCATTAACTTAAGTCTTTAGAG
                      ____________________________________________________________
consensus TATATATTGTACTTTCATTTATTTCTTTTTAAATAATATCATTAACTTAAGTCTTTAGAG
 
. : . : . : . : . : . :
rJMFF050N14+ TATAAGGTCTTCACTTGGAAGATACATGCTTATCACTAATAATAAATGGTTCAATTTTGG
                      ____________________________________________________________
consensus TATAAGGTCTTCACTTGGAAGATACATGCTTATCACTAATAATAAATGGTTCAATTTTGG