Previous Contig 011027:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I17Sequence530000102 (25)sp|Q9FYV1|INO1_SESIN4e-68Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (757011027 (22)sp|Q9FYV1|INO1_SESIN7e-83Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF007O16Sequence572000102 (25)sp|Q9FYV1|INO1_SESIN5e-77Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (757011027 (22)sp|Q9FYV1|INO1_SESIN7e-85Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF008D03Sequence595000102 (25)sp|Q9S7U0|INO1_WHEAT9e-72Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (779011027 (22)sp|Q9FYV1|INO1_SESIN2e-88Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF009A04Sequence555000102 (25)sp|Q9FYV1|INO1_SESIN1e-73Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (722011027 (22)sp|Q9FYV1|INO1_SESIN4e-79Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF009N20Sequence533000102 (25)sp|Q9FYV1|INO1_SESIN1e-68Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (663011027 (22)gb:AY323824_15993592e-67Xerophyta viscosa myo-inositol-1-phosphate synthase INO1 mRNA, complete cds.
JMFF018G19Sequence532000102 (25)sp|Q9FYV1|INO1_SESIN1e-68Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (738011027 (22)sp|Q9FYV1|INO1_SESIN1e-81Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF023M24Sequence514000102 (25)sp|Q9FYV1|INO1_SESIN2e-65Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (679011027 (22)sp|Q9FYV1|INO1_SESIN1e-73Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF024A19Sequence373000102 (25)sp|Q9FYV1|INO1_SESIN2e-37Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (728011027 (22)sp|Q9FYV1|INO1_SESIN1e-79Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF024L23Sequence495000102 (25)sp|Q9FYV1|INO1_SESIN2e-60Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (740011027 (22)sp|Q9FYV1|INO1_SESIN1e-81Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF025H22Sequence590000102 (25)sp|Q9FYV1|INO1_SESIN3e-80Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (774011027 (22)sp|Q9FYV1|INO1_SESIN7e-83Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF027M19Sequence598000102 (25)sp|Q9FYV1|INO1_SESIN6e-82Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (644011027 (22)sp|Q9FYV1|INO1_SESIN3e-62Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF033I19Sequence599000102 (25)sp|Q9FYV1|INO1_SESIN3e-81Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (712011027 (22)sp|Q9FYV1|INO1_SESIN4e-79Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF033O24Sequence595000102 (25)sp|Q9FYV1|INO1_SESIN3e-80Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (747011027 (22)sp|Q9FYV1|INO1_SESIN5e-84Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF037I12Sequence588000102 (25)sp|Q9FYV1|INO1_SESIN1e-79Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (752011027 (22)sp|Q9FYV1|INO1_SESIN3e-90Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF041M22Sequence636000102 (25)sp|Q9FYV1|INO1_SESIN7e-87Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (619011027 (22)sp|Q9FYV1|INO1_SESIN7e-55Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF042E01Sequence656000102 (25)sp|Q9FYV1|INO1_SESIN2e-90Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (619011027 (22)sp|Q9FYV1|INO1_SESIN2e-55Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFF050N03Sequence587000102 (25)sp|Q9FYV1|INO1_SESIN1e-79Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (533011027 (22)sp|Q40271|INO1_MESCR5e-34Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMFN030F11Sequence432011027 (22)gb:AJ853494_18149271e-24Phaseolus vulgaris mRNA for myo-inositol 1-phosphate synthase (mips gene).
JMFN042C09Sequence591011027 (22)sp|Q9LW96|INO1_TOBACe-103Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMSF002E16Sequence253000102 (25)sp|Q9FYV1|INO1_SESIN4e-12Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (726011027 (22)sp|Q9FYV1|INO1_SESIN4e-84Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMSF038I06Sequence675000102 (25)sp|Q9FYV1|INO1_SESIN2e-94Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (888011027 (22)sp|Q9FYV1|INO1_SESINe-132Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (
JMSF039O22Sequence687000102 (25)sp|Q9FYV1|INO1_SESIN1e-96Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (858011027 (22)sp|Q9FYV1|INO1_SESINe-106Inositol-3-phosphate synthase (EC 5.5.1.4) (Myo-inositol-1-phosphate synthase) (

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN042C09- GGACATCAAG
                      ____________________________________________________________
consensus GGACATCAAG
 
. : . : . : . : . : . :
JMFN042C09- GAGTTTAAGGAGAAGAGCAAGGTAGACAAGGTTGTTGTCCTGTGGACTGCCAACACAGAG
                      ____________________________________________________________
consensus GAGTTTAAGGAGAAGAGCAAGGTAGACAAGGTTGTTGTCCTGTGGACTGCCAACACAGAG
 
. : . : . : . : . : . :
JMFN042C09- AGATACAGTAATGTGGTTGTTGGGCTTAATGATACTGTGGAAAACCTCTTGGCTGCTTTG
                      ____________________________________________________________
consensus AGATACAGTAATGTGGTTGTTGGGCTTAATGATACTGTGGAAAACCTCTTGGCTGCTTTG
 
. : . : . : . : . : . :
JMFN042C09- GACAGAAATGAGGCTGAGATCTCTCCCTCTACCCTCTATGCCATAGCCTGTGTTATGGAG
rJMSF038I06+ TATGCCATAGCCTGTGTTATGGAG
                      ____________________________________________________________
consensus GACAGAAATGAGGCTGAGATCTCTCCCTCTACCCTCTATGCCATAGCCTGTGTTATGGAG
 
. : . : . : . : . : . :
JMFN042C09- AATGTTCCTTTCATCAATGGCAGCCCACAGAACACTTTTGTCCCAGGGCTCATTGATTTG
rJMSF038I06+ AATGTTCCTTTCATCAATGGCAGCCCACAGAACACTTTTGTCCCAGGGCTCATTGATTTG
                      ____________________________________________________________
consensus AATGTTCCTTTCATCAATGGCAGCCCACAGAACACTTTTGTCCCAGGGCTCATTGATTTG
 
. : . : . : . : . : . :
JMFN042C09- GCCATCAGGAGGAACAGTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGA-CCAAGAT
rJMSF038I06+ GCCATCAGGAGGAACAGTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGA-CCAAGAT
rJMSF039O22+ GACTTCAAGAGTGGTCAGACCCAAGAT
                      ____________________________________________________________
consensus GCCATCAGGAGGAACAGTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGA-CCAAGAT
 
. : . : . : . : . : . :
JMFN042C09- GAAATCAGTCCTGGTTGATTTCCTAGTTGGAGCTGGTATCAAGCCAACATCCATTGTCAG
rJMSF038I06+ GAAATCAGTCCTGGTTGATTTCCTAGTTGGAGCTGGTATCAAGCCAACATCCATTGTCAG
rJMSF039O22+ GAAATCAGTCCTGGTTGATTTCCTAGTTGGAGCTGGTATCAAGCCAACATCCATTGTCAG
                      ____________________________________________________________
consensus GAAATCAGTCCTGGTTGATTTCCTAGTTGGAGCTGGTATCAAGCCAACATCCATTGTCAG
 
. : . : . : . : . : . :
JMFN042C09- CTACAACCATTTGGGCAACAATGATGGCATGAACCTATCTGCCCCTCAAACTTT-CCGCT
rJMSF038I06+ CTACAACCATTTGGGCAACAATGATGGCATGAACCTATCTGCCCCTCAAACTTT-CCGCT
rJMFF037I12+ CAACAATGATGGCATGAACCTATCTGCCCCTCAAACTTT-CCGCT
rJMSF039O22+ CTACAACCATTTGGGCAACAATGATGGCATGAACCTATCTGCCCCTCAAACTTT-CCGCT
rJMFF003I17+ TCTGCCCCTCAAACTTTTCCGCT
rJMFF025H22+ ATGGCATGAACCTATCTGCCCCTCAAACTTTCCCGCT
rJMFF008D03+ ACAATGATGGCATGAACCTATCTGCCCNTCAAACTTT-CCGCT
rJMFF033O24+ TCAAACTTT-CCGCT
rJMFF024L23+ GCT
rJMFF018G19+ CT
rJMSF002E16+ TCAAACTTT-CCGCT
rJMFF009A04+ TTT-CCGCT
rJMFF007O16+ CCCCTCAAACTTT-CCGCT
                      ____________________________________________________________
consensus CTACAACCATTTGGGCAACAATGATGGCATGAACCTATCTGCCCCTCAAACTTT-CCGCT
 
. : . : . : . : . : . :
JMFN042C09- CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMSF038I06+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF037I12+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMSF039O22+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF033I19+ CG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF003I17+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF025H22+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF008D03+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF033O24+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF024L23+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF018G19+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF024A19+ TCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMSF002E16+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF009A04+ CCAAAGGAGATCTCGAAAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
rJMFF023M24+ TAGCAATGGCATCCT
rJMFF007O16+ CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
                      ____________________________________________________________
consensus CC-AAGGAGATCTCG-AAAAGCAATGTTGTTGATGACATGGTGGCTAGCAATGGCATCCT
 
. : . : . : . : . : . :
JMFN042C09- CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMSF038I06+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF037I12+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMSF039O22+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF033I19+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF003I17+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF025H22+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF008D03+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF033O24+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF024L23+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF018G19+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF024A19+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMSF002E16+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF009A04+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF023M24+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF009N20+ CATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
rJMFF027M19+ TGATCAAGTACGTGCCATACGTGGG
rJMFF007O16+ CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
                      ____________________________________________________________
consensus CTATGAACCCGGTGAACATCCTGACCATGTTGTCGTGATCAAGTACGTGCCATACGTGGG
 
. : . : . : . : . : . :
JMFN042C09- AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCAT
rJMSF038I06+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF037I12+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMSF039O22+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF033I19+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF003I17+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF025H22+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF008D03+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF033O24+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF024L23+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF018G19+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF024A19+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMSF002E16+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF009A04+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF023M24+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF009N20+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF027M19+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF007O16+ AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF042E01+ GCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
rJMFF041M22+ GCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
                      ____________________________________________________________
consensus AGACAGCAAGCGTGCAATGGATGAGTACACATCCGAGATTTTCATGGGCGGCAAGAGCAC
 
. : . : . : . : . : . :
rJMSF038I06+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF037I12+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMSF039O22+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF033I19+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF003I17+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF025H22+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF008D03+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF033O24+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF024L23+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF018G19+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF024A19+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMSF002E16+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF009A04+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF023M24+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF009N20+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF027M19+ CATAGCTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF007O16+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF042E01+ CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
rJMFF041M22+ CATAGCTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
                      ____________________________________________________________
consensus CATAGTTCTTCACAACACTTGTGAGGATTCACTCCTCGCAGCTCCCATCATCTTGGATTT
 
. : . : . : . : . : . :
rJMSF038I06+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF037I12+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMSF039O22+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF033I19+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF003I17+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF025H22+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF008D03+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF033O24+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF024L23+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF018G19+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF024A19+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMSF002E16+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF009A04+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF023M24+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF009N20+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF027M19+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF007O16+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF042E01+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF041M22+ GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
rJMFF050N03+ TCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
                      ____________________________________________________________
consensus GGTCCTCCTCGCTGAGCTCAGCACCCGCATCCAGCTCAAATCCGAGGAAGAGGCAAAGTT
 
. : . : . : . : . : . :
rJMSF038I06+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF037I12+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMSF039O22+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF033I19+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF003I17+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF025H22+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF008D03+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF033O24+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF024L23+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
JMFN030F11- CTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF018G19+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF024A19+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMSF002E16+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF009A04+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF023M24+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF009N20+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF027M19+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF007O16+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF042E01+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF041M22+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
rJMFF050N03+ CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
                      ____________________________________________________________
consensus CCACTCTTTCCACCCCGTGGCTACGATTCTCAGTTACCTCACCAAAGCTCCTTTGGTACC
 
. : . : . : . : . : . :
rJMSF038I06+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF037I12+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMSF039O22+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF033I19+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF003I17+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF025H22+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF008D03+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF033O24+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF024L23+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
JMFN030F11- ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF018G19+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF024A19+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMSF002E16+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF009A04+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF023M24+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF009N20+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF027M19+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF007O16+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF042E01+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF041M22+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
rJMFF050N03+ ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
                      ____________________________________________________________
consensus ACCAGGCACGCCAGTGGTGAATGCGCTGTCGAAGCAGCGTGCAATGCTGGAGAACATAAT
 
. : . : . : . : . : . :
rJMSF038I06+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF037I12+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMSF039O22+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF033I19+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF003I17+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF025H22+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF008D03+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF033O24+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF024L23+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
JMFN030F11- GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF018G19+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF024A19+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMSF002E16+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF009A04+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF023M24+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF009N20+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF027M19+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF007O16+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF042E01+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF041M22+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
rJMFF050N03+ GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
                      ____________________________________________________________
consensus GAGGGCTTGTGTCGGGCTGGCGCCAGAGAACAACATGATCTTAGAGTACAAGTGAAAGTC
 
. : . : . : . : . : . :
rJMSF038I06+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF037I12+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMSF039O22+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF033I19+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF003I17+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF025H22+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF008D03+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF033O24+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF024L23+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
JMFN030F11- TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF018G19+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF024A19+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMSF002E16+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF009A04+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF023M24+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF009N20+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF027M19+ TCTGAAAGTTGTGAA--GTAGATAGGGAAGAATGAGAGTTTACTTCCCTTTTGTTTTTAG
rJMFF007O16+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF042E01+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
rJMFF041M22+ TCTGAAAGTTGTGAA--GTAGATAGGGAAGAATGAGAGTTTACTTCCCTTTTGTTTTTAG
rJMFF050N03+ TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
                      ____________________________________________________________
consensus TCTGAAAGTTGTGAAGTGTAGATAGGGAAGAATGAGAGTTTACTTCCC-TTTGTTTTTAG
 
. : . : . : . : . : . :
rJMSF038I06+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF037I12+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMSF039O22+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF033I19+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF003I17+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF025H22+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF008D03+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF033O24+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF024L23+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
JMFN030F11- TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF018G19+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF024A19+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMSF002E16+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF009A04+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF023M24+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF009N20+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF027M19+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF007O16+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF042E01+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF041M22+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
rJMFF050N03+ TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
                      ____________________________________________________________
consensus TTTTGTCTACTCTTTTTCTTAGTAGAACAACCTTGTCATGTGTGTTCATGCTTTTAAGTG
 
. : . : . : . : . : . :
rJMSF038I06+ TACTATTTCTGGGAGTCCAAGGCAGAGGT
rJMFF037I12+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMSF039O22+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF033I19+ TACTA-TTCT-GGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF003I17+ TACTA-TTCT-GGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF025H22+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF008D03+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF033O24+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF024L23+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
JMFN030F11- TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF018G19+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF024A19+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMSF002E16+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF009A04+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF023M24+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF009N20+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF027M19+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF007O16+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF042E01+ TACTA-TTCT-GGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF041M22+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
rJMFF050N03+ TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
                      ____________________________________________________________
consensus TACTA-TTCTGGGAGTCCAAGGCAGAGGTTTTCTGTCTTTAATCATATTCAGGCTCTCTG
 
. : . : . : . : . : . :
rJMFF037I12+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCC
rJMSF039O22+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTT
rJMFF033I19+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF003I17+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF025H22+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF008D03+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF033O24+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF024L23+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
JMFN030F11- TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF018G19+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF024A19+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMSF002E16+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTT
rJMFF009A04+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCC
rJMFF023M24+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCA-TTTGAGAGCAGGCAACCCTTTTAATA
rJMFF009N20+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF027M19+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF007O16+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF042E01+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF041M22+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
rJMFF050N03+ TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
                      ____________________________________________________________
consensus TTAGTTTGTGTAAACAATTGTTGCTTTAGCTCATTTTGAGAGCAGGCAACCCTTTTAATA
 
. : . : . : . : . : . :
rJMFF033I19+ -TGGAAAATA
rJMFF003I17+ -TGGAAAATAGTACGGAGTA
rJMFF025H22+ -TGGAAAATAGTACGGAGTAAA
rJMFF008D03+ -TGGAAAATAGTACGGAGTAAA
rJMFF033O24+ -TGGAAAATAGTACGGAG
rJMFF024L23+ -TGGAAAATAGTACGGAGTAAA
JMFN030F11- TTGGAAAATAGTACGGAGT
rJMFF018G19+ TTGGAAAATAGTACGGAGTA
rJMFF024A19+ -TGGAAAATAGTACGGAGTAAA
rJMFF023M24+ -TGGAAAA
rJMFF009N20+ -TGGAAAATAGTACGGAGTAAA
rJMFF027M19+ TTGGAAAATAGTACGGAGTAAA
rJMFF007O16+ -TGGAAAATAGTACGGAGTAAATA
rJMFF042E01+ TTGGAAAATAGTACGGAGTAAATATATTTTTAAAT
rJMFF041M22+ TTGGAAAATAGTACGGAGTAAATATATTTTTAAAT
rJMFF050N03+ TTGGAAAATAGTACGGAGTAAATATATTTTTAAATAAAAAAAAAAAAAAAACTCTCCAGG
                      ____________________________________________________________
consensus -TGGAAAATAGTACGGAGTAAATATATTTTTAAATAAAAAAAAAAAAAAAACTCTCCAGG