Previous Contig 011020:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050M03Sequence631007903 (6)gb:AY087383_15724151e-31Arabidopsis thaliana clone 34800 mRNA, complete sequence.571011020 (5)gb:AY087383_15724151e-30Arabidopsis thaliana clone 34800 mRNA, complete sequence.
JMSF022J21Sequence639007903 (6)gb:AY087383_15724153e-55Arabidopsis thaliana clone 34800 mRNA, complete sequence.778011020 (5)gb:AY087383_15724151e-60Arabidopsis thaliana clone 34800 mRNA, complete sequence.
JMSF034F10Sequence689007903 (6)gb:AY087383_15724159e-41Arabidopsis thaliana clone 34800 mRNA, complete sequence.739011020 (5)gb:AY087383_15724158e-55Arabidopsis thaliana clone 34800 mRNA, complete sequence.
JMSF047K23Sequence693007903 (6)gb:AY087383_15724159e-42Arabidopsis thaliana clone 34800 mRNA, complete sequence.711011020 (5)gb:AY087383_15724153e-57Arabidopsis thaliana clone 34800 mRNA, complete sequence.
JMSF049D19Sequence693007903 (6)gb:AY087383_15724152e-42Arabidopsis thaliana clone 34800 mRNA, complete sequence.781011020 (5)gb:AY087383_15724157e-60Arabidopsis thaliana clone 34800 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047K23+ GTTAGGAAGACCATTGA
rJMSF022J21+ AAAAGTTCAGAACTTGGAGGTTAGGAAGACCATTGA
rJMSF049D19+ GGTTAAGGAAAAGTTCAGAACTTGGAGGTTAGGAAGACCATTGA
rJMSF034F10+ GA
                      ____________________________________________________________
consensus GGTTAAGGAAAAGTTCAGAACTTGGAGGTTAGGAAGACCATTGA
 
. : . : . : . : . : . :
rJMSF047K23+ AGCTTTGGATCAGTTAAGGGGAATGCCGGCTAGAGGAGATGTTGAGACTGGAGAAATCCC
rJMSF022J21+ AGCTTTGGATCAGTTAAGGGGAATGCCGGCTAGAGGAGATGTTGAGACTGGAGAAATCCC
rJMSF049D19+ AGCTTTGGATCAGTTAAGGGGAATGCCGGCTAGAGGAGATGTTGAGACTGGAGAAATCCC
rJMSF034F10+ AGCTTTGGATCAGTTAAGGGGAATGCCGGCTAGAGGAGATGTTGAGACTGGAGAAATCCC
                      ____________________________________________________________
consensus AGCTTTGGATCAGTTAAGGGGAATGCCGGCTAGAGGAGATGTTGAGACTGGAGAAATCCC
 
. : . : . : . : . : . :
rJMSF047K23+ ATCTTTGGTTGATTTGGGTCTCAATCCTACTGCTACAATGAGCCAGAATGGAAAGCCTGC
rJMSF022J21+ ATCTTTGGTTGATTTGGGTCTCAATCCTACTGCTACAATGAGCCAGAATGGAAAGCCTGC
rJMSF049D19+ ATCTTTGGTTGATTTGGGTCTCAATCCTACTGCTACAATGAGCCAGAATGGAAAGCCTGC
rJMSF034F10+ ATCTTTGGTTGATTTGGGTCTCAATCCTACTGCTACAATGAGCCAGAATGGAAAGCCTGC
                      ____________________________________________________________
consensus ATCTTTGGTTGATTTGGGTCTCAATCCTACTGCTACAATGAGCCAGAATGGAAAGCCTGC
 
. : . : . : . : . : . :
rJMSF047K23+ TGCTAATGCTTCCCTTGTTGGAGGAGAGAGCGAAGCCTTGCAGAGAGTTAAGAAGTTTGC
rJMSF022J21+ TGCTAATGCTTCCCTTGTTGGAGGAGAGAGCGAAGCCTTGCAGAGAGTTAAGAAGTTTGC
rJMSF049D19+ TGCTAATGCTTCCCTTGTTGGAGGAGAGAGCGAAGCCTTGCAGAGAGTTAAGAAGTTTGC
rJMSF034F10+ TGCTAATGCTTCCCTTGTTGGAGGAGAGAGCGAAGCCTTGCAGAGAGTTAAGAAGTTTGC
                      ____________________________________________________________
consensus TGCTAATGCTTCCCTTGTTGGAGGAGAGAGCGAAGCCTTGCAGAGAGTTAAGAAGTTTGC
 
. : . : . : . : . : . :
rJMSF047K23+ AGCTGAATGCCAAGAGCAACCGAATCAAGGAAACAAGACTGGTGGAAACGATAGCATATA
rJMSF022J21+ AGCTGAATGCCAAGAGCAACCGAATCAAGGAAACAAGACTGGTGGAAACGATAGCATATA
rJMSF049D19+ AGCTGAATGCCAAGAGCAACCGAATCAAGGAAACAAGACTGGTGGAAACGATAGCATATA
rJMSF034F10+ AGCTGAATGCCAAGAGCAACCGAATCAAGGAAACAAGACTGGTGGAAACGATAGCATATA
rJMFF050M03+ GAAACAAGACTGGTGGAAACGATAGCATATA
                      ____________________________________________________________
consensus AGCTGAATGCCAAGAGCAACCGAATCAAGGAAACAAGACTGGTGGAAACGATAGCATATA
 
. : . : . : . : . : . :
rJMSF047K23+ CGGTGCAAACTTTTCCTGCAAAATATCTCCCTGGCTCGCTATGGGATGCCTCTCCCCTCG
rJMSF022J21+ CGGTGCAAACTTTTCCTGCAAAATATCTCCCTGGCTCGCTATGGGATGCCTCTCCCCTCG
rJMSF049D19+ CGGTGCAAACTTTTCCTGCAAAATATCTCCCTGGCTCGCTATGGGATGCCTCTCCCCTCG
rJMSF034F10+ CGGTGCAAACTTTTCCTGCAAAATATCTCCCTGGCTCGCTATGGGATGCCTCTCCCCTCG
rJMFF050M03+ CGGTGCAAACTTTTCCTGCAAAATATCTCCCTGGCTCGCTATGGGATGCCTCTCCCCTCG
                      ____________________________________________________________
consensus CGGTGCAAACTTTTCCTGCAAAATATCTCCCTGGCTCGCTATGGGATGCCTCTCCCCTCG
 
. : . : . : . : . : . :
rJMSF047K23+ GTCTATGTTTGATGAGTTGAAGAAGTCTACATCAAGAAAATTTCCTGTTGCCTCTAAAGT
rJMSF022J21+ GTCTATGTTTGATGAGTTGAAGAAGTCTACATCAAGAAAATTTCCTGTTGCCTCTAAAGT
rJMSF049D19+ GTCTATGTTTGATGAGTTGAAGAAGTCTACATCAAGAAAATTTCCTGTTGCCTCTAAAGT
rJMSF034F10+ GTCTATGTTTGATGAGTTGAAGAAGTCTACATCAAGAAAATTTCCTGTTGCCTCTAAAGT
rJMFF050M03+ GTCTATGTTTGATGAGTTGAAGAAGTCTACATCAGGAAAATTTCCTGTTGCCTCTAAAGT
                      ____________________________________________________________
consensus GTCTATGTTTGATGAGTTGAAGAAGTCTACATCAAGAAAATTTCCTGTTGCCTCTAAAGT
 
. : . : . : . : . : . :
rJMSF047K23+ GAAAGATGGTGGTAGCGGTGGCACTGGACCAAACTGGTTGATGTATGAGCTGATGTGGAG
rJMSF022J21+ GAAAGATGGTGGTAGCGGTGGCACTGGACCAAACTGGTTGATGTATGAGCTGATGTGGAG
rJMSF049D19+ GAAAGATGGTGGTAGCGGTGGCACTGGACCAAACTGGTTGATGTATGAGCTGATGTGGAG
rJMSF034F10+ GAAAGATGGTGGTAGCGGTGGCACTGGACCAAACTGGTTGATGTATGAGCTGATGTGGAG
rJMFF050M03+ GAAAGATGGTGGTAGCGGTGGCACTGGACCAAACTGGTTGATGTATGAGCTGATGTGGAG
                      ____________________________________________________________
consensus GAAAGATGGTGGTAGCGGTGGCACTGGACCAAACTGGTTGATGTATGAGCTGATGTGGAG
 
. : . : . : . : . : . :
rJMSF047K23+ AGATTTCTTCAGATTCATCACCAAGAAATACAGCTCTGCTAGACAAAACAGCACCGCCCC
rJMSF022J21+ AGATTTCTTCAGATTCATCACCAAGAAATACAGCTCTGCTAGACAAAACAGCACCGCCCC
rJMSF049D19+ AGATTTCTTCAGATTCATCACCAAGAAATACAGCTCTGCTAGACAAAACAGCACCGCCCC
rJMSF034F10+ AGATTTCTTCAGATTCATCACCAAGAAATACAGCTCTGCTAGACAAAACAGCACCGCCCC
rJMFF050M03+ AGATTTCTTCAGATTCATCACCAAGAAATACAGCTCTGCTAGACAAAACAGCACCGCCCC
                      ____________________________________________________________
consensus AGATTTCTTCAGATTCATCACCAAGAAATACAGCTCTGCTAGACAAAACAGCACCGCCCC
 
. : . : . : . : . : . :
rJMSF047K23+ AGTGACAGTATGTGCAGGGGCCGCGGTAAATTGAAATAGACATCATTGTACCAGGGAAGA
rJMSF022J21+ AGTGACAGTATGTGCAGGGGCCGCGGTAAATTGAAATAGACATCATTGTACCAGGGAAGA
rJMSF049D19+ AGTGACAGTATGTGCAGGGGCCGCGGTAAATTGAAATAGACATCATTGTACCAGGGAAGA
rJMSF034F10+ AGTGACAGTATGTGCAGGGGCCGCGGTAAATTGAAATAGACATCATTGTACCAGGGAAGA
rJMFF050M03+ AGTGACAGTATGTGCAGGGGCCGCGGTAAATTGAAATAGACATCATTGTACCAGGGAAGA
                      ____________________________________________________________
consensus AGTGACAGTATGTGCAGGGGCCGCGGTAAATTGAAATAGACATCATTGTACCAGGGAAGA
 
. : . : . : . : . : . :
rJMSF047K23+ ACTTCACCTCGTATCTTCATTTGACATCAATGAAGCAGGGAGTATTGAGGTTGTCTAAAT
rJMSF022J21+ ACTTCACCTCGTATCTTCATTTGACATCAATGAAGCAGGGAGTATTGAGGTTGTCTAAAT
rJMSF049D19+ ACTTCACCTCGTATCTTCATTTGACATCAATGAAGCAGGGAGTATTGAGGTTGTCTAAAT
rJMSF034F10+ ACTTCACCTCGTATCTTCGTTTGACATCAATGAAGCAGGGAGTATTGAGGTTGTCTAAAT
rJMFF050M03+ ACTTCACCTCGTATCTTCATTTGACATCAATGAAGCAGGGAGTATTGAGGTTGTCTAAAT
                      ____________________________________________________________
consensus ACTTCACCTCGTATCTTCATTTGACATCAATGAAGCAGGGAGTATTGAGGTTGTCTAAAT
 
. : . : . : . : . : . :
rJMSF047K23+ AAGGTTGATAGAAATTCATCATTTGTAGCTAGCAGTGTTTAGTGACTTTAGTCTATTTCC
rJMSF022J21+ AAGGTTGATAGAAATTCATCATTTGTAGCTAGCAGTGTTTAGTGACTTTAGTCTATTTCC
rJMSF049D19+ AAGGTTGATAGAAATTCATCATTTGTAGCTAGCAGTGTTTAGTGACTTTAGTCTATTTCC
rJMSF034F10+ AAGGTTGATAGAAATTCATCATTTGTAGCTAGCAGTGTTTAGTGACTTTAGTCTATTTCC
rJMFF050M03+ AAGGTTGATAGAAATTCATCATTTGTAGCTAGCAGTGTTTAGTGACTTTAGTCTATTTCC
                      ____________________________________________________________
consensus AAGGTTGATAGAAATTCATCATTTGTAGCTAGCAGTGTTTAGTGACTTTAGTCTATTTCC
 
. : . : . : . : . : . :
rJMSF047K23+ CAGACTGTCTTCTTGGTAGGCTATGGTGTGTTTT
rJMSF022J21+ CAGACTGTCTTCTTGGTAGGCTATGGTGTGTTTTTGTATTGTGGACATTTGTCGAAAAGC
rJMSF049D19+ CAGACTGTCTTCTTGGTAGGCTATGGTGTGTTTTTGTATTGTGGACATTTGTCGAAAAGC
rJMSF034F10+ CAGACTGTCTTCTTGGTAGGCTATGGTGTGTTTTTGTATTGTGGACATTTGTCGAAAAGC
rJMFF050M03+ CAGACTGTCTTCTTGGTAGGCTATGGTGTGTTTTTGTATTGTGGACATTTGTCGAAAAGC
                      ____________________________________________________________
consensus CAGACTGTCTTCTTGGTAGGCTATGGTGTGTTTTTGTATTGTGGACATTTGTCGAAAAGC
 
. : . : . : . : . : . :
rJMSF022J21+ TGCTCATGCTAGAGAT
rJMSF049D19+ TGCTCATGCTAGAGAT
rJMSF034F10+ TGCTCATGCTAGAGAT
rJMFF050M03+ TGCTCATGCTAGAGATTAATATCTATTCTGTAAAATCTATATAATTGAATTAAAGAATCC
                      ____________________________________________________________
consensus TGCTCATGCTAGAGATTAATATCTATTCTGTAAAATCTATATAATTGAATTAAAGAATCC