Previous Contig 011011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012K07Sequence107000733 (5)770011011 (10)gb:BT004111_16372124e-46Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel
JMFF014B13Sequence386000733 (5)544011011 (10)gb:BT004111_16372127e-09Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel
JMFF040I13Sequence436000733 (5)704011011 (10)gb:BT004111_16372129e-39Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel
JMFF041P22Sequence604000733 (5)gb:BT004111_16372128e-05Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel598011011 (10)gb:BT004111_16372122e-31Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel
JMFF047P10Sequence587000733 (5)gb:BT004111_16372128e-05Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel479011011 (10)
JMFF050K11Sequence635002164 (2)544011011 (10)
JMFN004D24Sequence627011011 (10)gb:BT004111_16372126e-67Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel
JMFS150F10Sequence513011011 (10)
JMSF031J19Sequence747011011 (10)gb:BT004111_16372128e-37Arabidopsis thaliana clone RAFL15-24-L23 (R20600) putative DEAD/DEAH box RNA hel
JMSF040A21Sequence130011011 (10)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN004D24- T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFN004D24- TACACTTGTTTTTGTGGAGACGAAGAAAGGAGCTGATTCTCTAGAACATTGGCTCTGTAT
                      ____________________________________________________________
consensus TACACTTGTTTTTGTGGAGACGAAGAAAGGAGCTGATTCTCTAGAACATTGGCTCTGTAT
 
. : . : . : . : . : . :
JMFN004D24- TAACGGTTTCCCCGCTACTGCTATACATGGTGATAGGACACAACAGGAAAGAGAACAAGC
rJMFF012K07+ CAGGAAAGAGANCAAGC
                      ____________________________________________________________
consensus TAACGGTTTCCCCGCTACTGCTATACATGGTGATAGGACACAACAGGAAAGAGAACAAGC
 
. : . : . : . : . : . :
JMFN004D24- TTTGAGGGCTTTCAAAAGTGGCAGGACGCCGATTCTGGTTGCAACAGACGTGGCGGCACG
rJMFF040I13+ ATTCTGGTTGCAACAGACGTGGCGGCACG
rJMFF012K07+ TTTGAGGGCTTTCAAAAGTGGCAGGACGCCGATTCTGGTTGCAACAGACGTGGCGGCACG
rJMSF031J19+ AAAGTGGCAGGACGCCGATTCTGGTTGCAACAGACGTGGCGGCACG
                      ____________________________________________________________
consensus TTTGAGGGCTTTCAAAAGTGGCAGGACGCCGATTCTGGTTGCAACAGACGTGGCGGCACG
 
. : . : . : . : . : . :
JMFN004D24- TGGTCTCGACATTCCTCACGTTGCTCACGTGGTCAACTTCGACCTCCCAAATGACATTGA
rJMFF040I13+ TGGTCTCGACATTCCTCACGTTGCTCACGTGGTCAACTTCGACCTCCCAAATGACATTGA
rJMFF041P22+ TCCTCACGTTGCTCACGTGGTCAACTTCGACCTCCCAAATGACATTGA
rJMFF012K07+ TGGTCTCGACATTCCTCACGTTGCTCACGTGGTCAACTTCGACCTCCCAAATGACATTGA
rJMSF031J19+ TGGTCTCGACA-TCCTCACGTTGCTCACGTGGTCAACTTCGACCTCCCAAATGACATTGA
                      ____________________________________________________________
consensus TGGTCTCGACATTCCTCACGTTGCTCACGTGGTCAACTTCGACCTCCCAAATGACATTGA
 
. : . : . : . : . : . :
JMFN004D24- CGATTATGTCCACCGCATAGGAAGAACTGGACGAGCAGGAAAAACCGGCCTGGCCACCGC
rJMFF040I13+ CGATTATGTCCACCGCATAGGAAGAACTGGACGAGCAGGAAAAACCGGCCTGGCCACCGC
rJMFF041P22+ CGATTATGTCCACCGCATAGGAAGAACTGGACGAGCAGGAAAAACCGGCCTGGCCACCGC
rJMFF012K07+ CGATTATGTCCACCGCATAGGAAGAACTGGACGAGCAGGAAAAACCGGCCTGGCCACCGC
rJMSF031J19+ CGATTATGTCCACCGCATAGGAAGAACTGGACGAGCAGGAAAAACCGGCCTGGCCACCGC
                      ____________________________________________________________
consensus CGATTATGTCCACCGCATAGGAAGAACTGGACGAGCAGGAAAAACCGGCCTGGCCACCGC
 
. : . : . : . : . : . :
JMFN004D24- CTTCTTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
rJMFF040I13+ CTTCTTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
rJMFF041P22+ CTTCTTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
rJMFF014B13+ TTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
rJMFF012K07+ CTTCTTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
rJMSF031J19+ CTTCTTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
                      ____________________________________________________________
consensus CTTCTTCAACGAGGGCAATTCCTCTCTCGCGCGCTCCTTGGCAGATCTGATGCAAGAAGC
 
. : . : . : . : . : . :
JMFN004D24- AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
rJMFF040I13+ AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
rJMFF041P22+ AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
rJMFF014B13+ AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
rJMFF012K07+ AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
JMFS150F10- AACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
rJMSF031J19+ AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
rJMFF050K11+ AGGCAA
                      ____________________________________________________________
consensus AAACCAAGAAGTACCTGCCTGGCTTTCCCGCTATGCTGCTAGATCCTCCCACGGAGGCAA
 
. : . : . : . : . : . :
JMFN004D24- AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMFF040I13+ AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMFF041P22+ AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMFF014B13+ AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMFF012K07+ AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
JMFS150F10- AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMSF031J19+ AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMFF047P10+ GGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
rJMFF050K11+ AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
                      ____________________________________________________________
consensus AAGCCGCCGGGGTGCCGGCCGCTTCGGCGGCCGTGATTTCCGAAGAGATTCCTCTTCCTC
 
. : . : . : . : . : . :
JMFN004D24- TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMFF040I13+ TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMFF041P22+ TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMFF014B13+ TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMFF012K07+ TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
JMFS150F10- TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMSF031J19+ TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMFF047P10+ TTTCAACCGAGGCAATCCCGACTATTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
rJMFF050K11+ TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
                      ____________________________________________________________
consensus TTTCAACCGAGGCAATCCCGACTACTACTCTGGCGGCAACACGGGCGGCGGTTACAGTGG
 
. : . : . : . : . : . :
JMFN004D24- GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMFF040I13+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMFF041P22+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMFF014B13+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMFF012K07+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
JMFS150F10- GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMSF031J19+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMFF047P10+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
rJMFF050K11+ GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
                      ____________________________________________________________
consensus GTTCGGGGGCGGGTACAATCCATCGTACGGAGCTGGCGTGGCCAGCGCCTGGGACTAACA
 
. : . : . : . : . : . :
JMFN004D24- GCCCACCCACACTTGATCAATCTGGC
rJMFF040I13+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
rJMFF041P22+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
rJMFF014B13+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
rJMFF012K07+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
JMFS150F10- GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
rJMSF031J19+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
rJMFF047P10+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
rJMFF050K11+ GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
                      ____________________________________________________________
consensus GCCCACCCACACTTGATCAATCTGGCAACAGAAGTTAGTAGTAGAATACACTTCCTCACT
 
. : . : . : . : . : . :
rJMFF040I13+ TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
rJMFF041P22+ TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
rJMFF014B13+ TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
rJMSF040A21+ GTCGTCGTTCAGTCATGGAATTGAAGC
rJMFF012K07+ TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
JMFS150F10- TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
rJMSF031J19+ TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
rJMFF047P10+ TTTAAGATATTTTATCGTGTTCTTTTCGTCTTGGTCGTCGTTC-GTCATGGAATTGAAGC
rJMFF050K11+ TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
                      ____________________________________________________________
consensus TTTTAGATATTTTATCGTGTTCTTTTCGTCTTTGTCGTCGTTC-GTCATGGAATTGAAGC
 
. : . : . : . : . : . :
rJMFF040I13+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
rJMFF041P22+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
rJMFF014B13+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
rJMSF040A21+ TTATANTTCGTCNTCCTTTTTGTACTGGAACTTTTGACCTTAAAGATNGGTGGTNTGANG
rJMFF012K07+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
JMFS150F10- TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
rJMSF031J19+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
rJMFF047P10+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
rJMFF050K11+ TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
                      ____________________________________________________________
consensus TTCTACTTCGTCTTCCTTTTTGTACTGGAATTTTTGACCTTAAAGATGGGTGGTGTGAGG
 
. : . : . : . : . : . :
rJMFF040I13+ GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
rJMFF041P22+ GAGAGTATTGT
rJMFF014B13+ GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
rJMSF040A21+ GAGAGNATAGTAATCATCTGGGCTCCATGGGTATGTGTAAATG
rJMFF012K07+ GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
JMFS150F10- GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAACTGTTGGCAGGAGGCATGAA
rJMSF031J19+ GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
rJMFF047P10+ GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
rJMFF050K11+ GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
                      ____________________________________________________________
consensus GAGAGTATTGTAATCA-CTGGGCTCCATGGGTATGTGTAAATGTTGGCAGGAGGCATGAA
 
. : . : . : . : . : . :
rJMFF040I13+ TAATCTGCTAACAACTT
rJMFF014B13+ TAATCTGCTA
rJMFF012K07+ TAATCTGCTAACAACTTCTTAAGGTGTATGTAATC
JMFS150F10- TAATCTGCTAACAACTTCTTAAGGTGTATGTAATCT
rJMSF031J19+ TAATCTGCTAACAACTTCTTAAGGTGTATGTAATCTTTGCCTT
rJMFF047P10+ TAATCTGCTAACAACTTCTTAAGGTGTATGTAATCTTTGCCTTTAACTTATCATCCCATT
rJMFF050K11+ TAATCTGCTAACAACTTCTTAAGGTGTATGTAATCTTTGCCTTTAACTTATCATCCCATT
                      ____________________________________________________________
consensus TAATCTGCTAACAACTTCTTAAGGTGTATGTAATCTTTGCCTTTAACTTATCATCCCATT
 
. : . : . : . : . : . :
rJMFF047P10+ TCATCTTTGAC
rJMFF050K11+ TCATCTTTGACATTTGATTTCAAGGATTATGCTTAGTCTCTTAAAAAAAAAAAAAAAAAT
                      ____________________________________________________________
consensus TCATCTTTGACATTTGATTTCAAGGATTATGCTTAGTCTCTTAAAAAAAAAAAAAAAAAT