Previous Contig 011008:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050J14Sequence609011008 (2)sp|Q9SMZ9|15E1_ARATH2e-24Hypothetical UPF0203 protein At4g33100.>pir|T05190|T05190 hypothetical protein F547011008 (2)sp|Q9SMZ9|15E1_ARATH6e-22Hypothetical UPF0203 protein At4g33100.>pir|T05190|T05190 hypothetical protein F

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050J14- GCAT
                      ____________________________________________________________
consensus GCAT
 
. : . : . : . : . : . :
JMFF050J14- TGCTTTTCCGACAACTGGGTAGCCGCTTATGGTTTTTAGCTGCTTACAGAAATGGGGATT
                      ____________________________________________________________
consensus TGCTTTTCCGACAACTGGGTAGCCGCTTATGGTTTTTAGCTGCTTACAGAAATGGGGATT
 
. : . : . : . : . : . :
JMFF050J14- AAGAAGGAGAAGAAAACTTCATCTTCCTCAGCAACTTCACCTTGCGCCCACCTCAGAGAA
rJMFF050J14+ CAGAGAA
                      ____________________________________________________________
consensus AAGAAGGAGAAGAAAACTTCATCTTCCTCAGCAACTTCACCTTGCGCCCACCTCAGAGAA
 
. : . : . : . : . : . :
JMFF050J14- GCTTACCACAATTGCTTCAACAGATGGTATTCTGAGAAGTTCTTGAAGGGTCAATGGGAT
rJMFF050J14+ GCTTACCACAATTGCTTCAACAGATGGTATTCTGAGAAGTTCTTGAAGGGTCAATGGGAT
                      ____________________________________________________________
consensus GCTTACCACAATTGCTTCAACAGATGGTATTCTGAGAAGTTCTTGAAGGGTCAATGGGAT
 
. : . : . : . : . : . :
JMFF050J14- AAAGAAGAATGCGTTTCGGAGTGGCAGAAATATCGAGATTGTCTTTCTCAACATTTGGAT
rJMFF050J14+ AAAGAAGAATGCGTTTCGGAGTGGCAGAAATATCGAGATTGTCTTTCTCAACATTTGGAT
                      ____________________________________________________________
consensus AAAGAAGAATGCGTTTCGGAGTGGCAGAAATATCGAGATTGTCTTTCTCAACATTTGGAT
 
. : . : . : . : . : . :
JMFF050J14- GATAAATATTTGAGTAGATTCTTGGAAGCGGAGGGCACTATCAATTTGGGCAATCAAACT
rJMFF050J14+ GATAAATATTTGAGTAGATTCTTGGAAGCGGAGGGCACTATCAATTTGGGCAATCAAACT
                      ____________________________________________________________
consensus GATAAATATTTGAGTAGATTCTTGGAAGCGGAGGGCACTATCAATTTGGGCAATCAAACT
 
. : . : . : . : . : . :
JMFF050J14- GATTTTAGTGGCCCTGCCGGAGCTCCTAGACAATAGCAACTCTATAACTTATGGAGATAC
rJMFF050J14+ GATTTTAGGGGCCCTGCCGGAGCTCCTAGACAATAGCAACTCTATAACTTATGGAGATAC
                      ____________________________________________________________
consensus GATTTTAGTGGCCCTGCCGGAGCTCCTAGACAATAGCAACTCTATAACTTATGGAGATAC
 
. : . : . : . : . : . :
JMFF050J14- TTGAGAAAGGATGCCAAGAAATTGCACTTTTTTGCTGCTCTTCTGGACAGTCTACATATT
rJMFF050J14+ TTGAGAAAGGATGCCAAGAAATTGCACTTTTTTGCTGCTCTTCTGGACAGTCTACATATT
                      ____________________________________________________________
consensus TTGAGAAAGGATGCCAAGAAATTGCACTTTTTTGCTGCTCTTCTGGACAGTCTACATATT
 
. : . : . : . : . : . :
JMFF050J14- AAGTTCAGCCTTTAATCTGGTTAAATGCTTTTGCTGTTGCTTTTCAACAGTTTGCCATAG
rJMFF050J14+ AAGTTCAGCCTTTAATCTGGTTAAATGCTTTTGCTGTTGCTTTTCAACAGTTTGCCATAG
                      ____________________________________________________________
consensus AAGTTCAGCCTTTAATCTGGTTAAATGCTTTTGCTGTTGCTTTTCAACAGTTTGCCATAG
 
. : . : . : . : . : . :
JMFF050J14- GCCCTAATAATGGGATTACAGGTACATGTATGAGATATTGAGATTCTATGCAAGAAGACT
rJMFF050J14+ GCCCTAATAATGGGATTACAGGTACATGTATGAGATATTGAGATTCTATGCAAGAAGACT
                      ____________________________________________________________
consensus GCCCTAATAATGGGATTACAGGTACATGTATGAGATATTGAGATTCTATGCAAGAAGACT
 
. : . : . : . : . : . :
JMFF050J14- GCAGCTTCTACAANAATCTTCCTTTTTTTTGTATGGGAAGTAGGAAAGTAGCTCGAATTG
rJMFF050J14+ GCAGCTTCTACAAAAATCTTCCTTTTTTTTGTATGGGAAGTAGGAAAGTAGCTCGAATTG
                      ____________________________________________________________
consensus GCAGCTTCTACAAAAATCTTCCTTTTTTTTGTATGGGAAGTAGGAAAGTAGCTCGAATTG
 
. : . : . : . : . : . :
JMFF050J14- CTATC
rJMFF050J14+ CTATCTTTTATTTGTATTAAATGTTGAAATGTTATCAATGAATTTGAAATGAATTTTACC
                      ____________________________________________________________
consensus CTATCTTTTATTTGTATTAAATGTTGAAATGTTATCAATGAATTTGAAATGAATTTTACC