Previous Contig 011002:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009I15Sequence574000500 (3)gb:AY080728_15684472e-37Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds716011002 (5)gb:AY080728_15684472e-92Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds
JMFF050I08Sequence605011002 (5)gb:AY080728_1568447e-103Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds582011002 (5)gb:AY080728_15684472e-52Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds
JMFS069D04Sequence641011002 (5)gb:AY080728_15684478e-84Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds
JMSF025D22Sequence692000500 (3)gb:AY080728_15684475e-55Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds739011002 (5)gb:AY080728_15684477e-93Arabidopsis thaliana putative prolyl endopeptidase (At1g76140) mRNA, partial cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050I08- GCCGGAAAAGATATATCTTTGGATGGATCACACCCTTGTTTACTGTAT
                      ____________________________________________________________
consensus GCCGGAAAAGATATATCTTTGGATGGATCACACCCTTGTTTACTGTAT
 
. : . : . : . : . : . :
JMFF050I08- GGATATGGTGGATTTAACATAAACATTACCCCATACTTTTCTGTTCCCCGGCTAGTGATT
                      ____________________________________________________________
consensus GGATATGGTGGATTTAACATAAACATTACCCCATACTTTTCTGTTCCCCGGCTAGTGATT
 
. : . : . : . : . : . :
JMFF050I08- GCAAAGCATTTAGGTGTTGTTTTCTGCATAGCAAATATTCGTGGTGGAGGGGAATACGGA
                      ____________________________________________________________
consensus GCAAAGCATTTAGGTGTTGTTTTCTGCATAGCAAATATTCGTGGTGGAGGGGAATACGGA
 
. : . : . : . : . : . :
JMFF050I08- GAAGAATGGCATAAAGCTGGTGCTCTTGCAAAAAAGCAAAACTGCTTTGATGATTTCATT
                      ____________________________________________________________
consensus GAAGAATGGCATAAAGCTGGTGCTCTTGCAAAAAAGCAAAACTGCTTTGATGATTTCATT
 
. : . : . : . : . : . :
JMFF050I08- TCTGCTACCGAGTATCTTGTTAGCACTGGTTACACCCAACCTAGCAAGCTGTGCATTGAA
JMFS069D04- GTGCATTGAA
rJMFF009I15+ TCTGCTGCCGAGTATCTTGTTAGCACTGGTTACACCCAACCTAGCAAGCTGTGCATTGAA
rJMSF025D22+ TCTGCTGCCGAGTATCTTGTTAGCACTGGTTACACCCAACCTAGCAAGCTGTGCATTGAA
                      ____________________________________________________________
consensus TCTGCTGCCGAGTATCTTGTTAGCACTGGTTACACCCAACCTAGCAAGCTGTGCATTGAA
 
. : . : . : . : . : . :
JMFF050I08- GGTGGAAGCAATGGTGGGCTTCTAATTGGGGCTTGCATCAATCAGAGACCTGATCTTTTC
JMFS069D04- GGTGGAAGCAATGGTGGGCTTCTAATTGGGGCTTGCATCAATCAGAGACCTGATCTTTTC
rJMFF009I15+ GGTGGAAGCAATGGTGGGCTTCTAATTGGGGCTTGCATCAATCAGAGACCTGATCTTTTC
rJMSF025D22+ GGTGGAAGCAATGGTGGGCTTCTAATTGGGGCTTGCATCAATCAGAGACCTGATCTTTTC
                      ____________________________________________________________
consensus GGTGGAAGCAATGGTGGGCTTCTAATTGGGGCTTGCATCAATCAGAGACCTGATCTTTTC
 
. : . : . : . : . : . :
JMFF050I08- GGCTGTGCTCTTGCACATGTTGGTGTTATGGATATGCTTAGGTTTCACAAGTTTACGATT
JMFS069D04- GGCTGTGCTCTTGCACATGTTGGTGTTATGGATATGCTTAGGTTTCACAAGTTTACGATT
rJMFF009I15+ GGCTGTGCTCTTGCACATGTTGGTGTTATGGATATGCTTAGGTTTCACAAGTTTACGATT
rJMSF025D22+ GGCTGTGCTCTTGCACATGTTGGTGTTATGGATATGCTTAGGTTTCACAAGTTTACGATT
                      ____________________________________________________________
consensus GGCTGTGCTCTTGCACATGTTGGTGTTATGGATATGCTTAGGTTTCACAAGTTTACGATT
 
. : . : . : . : . : . :
JMFF050I08- GGCCATGCATGGACATCTGACTATGGGTGTTCAGAGAAGGAGGAAGAATTTCATTGGCTG
JMFS069D04- GGCCATGCATGGACATCTGACTATGGGTGTTCAGAGAAGGAGGAAGAATTTCATTGGCTG
rJMFF009I15+ GGCCATGCATGGACATCTGACTATGGGTGTTCAGAGAAGGAGGAAGAATTTCATTGGCTG
rJMSF025D22+ GGCCATGCATGGACATCTGACTATGGGTGTTCAGAGAAGGAGGAAGAATTTCATTGGCTG
rJMFF050I08+ GACTATGGGTGTTCAGAGAAGGAGGAAGAATTTCATTGGCTG
                      ____________________________________________________________
consensus GGCCATGCATGGACATCTGACTATGGGTGTTCAGAGAAGGAGGAAGAATTTCATTGGCTG
 
. : . : . : . : . : . :
JMFF050I08- TTCAAGTACTCACCACTACATAATGTGAAAAGACCATGGGAACAAACTTCCAGTANAGCT
JMFS069D04- TTCAAGTACTCACCACTACATAATGTGAAAAGACCATGGGAACAAACTTCCAGTAAAGCT
rJMFF009I15+ TTCAAGTACTCACCACTACATAATGTGAAAAGACCATGGGAACAAACTTCCAGTAAAGCT
rJMSF025D22+ TTCAAGTACTCACCACTACATAATGTGAAAAGACCATGGGAACAAACTTCCAGTAAAGCT
rJMFF050I08+ TTCAAGTACTCACCACTACATAATGTGAAAAGACCATGGGAACAAACTTCCAGTAAAGCT
                      ____________________________________________________________
consensus TTCAAGTACTCACCACTACATAATGTGAAAAGACCATGGGAACAAACTTCCAGTAAAGCT
 
. : . : . : . : . : . :
JMFF050I08- TCTCAATACCCATCGACCATGCTATTGACAGCTGATCATGACGATAGGGGTGTGCCATTA
JMFS069D04- TCTCAATACCCATCGACCATGCTATTGACAGCTGATCATGACGATAGGGTTGTGCCATTA
rJMFF009I15+ TCTCAATACCCATCGACCATGCTATTGACAGCTGATCATGACGATAGGGTTGTGCCATTA
rJMSF025D22+ TCTCAATACCCATCGACCATGCTATTGACAGCTGATCATGACGATAGGGTTGTGCCATTA
rJMFF050I08+ TCTCAATACCCATCGACCATGCTATTGACAGCTGATCATGACGATAGGGTTGTGCCATTA
                      ____________________________________________________________
consensus TCTCAATACCCATCGACCATGCTATTGACAGCTGATCATGACGATAGGGTTGTGCCATTA
 
. : . : . : . : . : . :
JMFF050I08- CCCACATTGAAATTATT
JMFS069D04- CACACATTGAAATTATTGGCGACCATGCAATACGTGTTATGTACAAGCCCGGAGAAAAGC
rJMFF009I15+ CACACATTGAAATTATTGGCGACCATGCAATACGTGTTATGTACAAGCCCGGAGAAAAGC
rJMSF025D22+ CACACATTGAAATTATTGGCGACCATGCAATACGTGTTATGTACAAGCCCGGAGAAAAGC
rJMFF050I08+ CACACATTGAAATTATTGGCGACCATGCAATACGTGTTATGTACAAGCCCGGAGAAAAGC
                      ____________________________________________________________
consensus CACACATTGAAATTATTGGCGACCATGCAATACGTGTTATGTACAAGCCCGGAGAAAAGC
 
. : . : . : . : . : . :
JMFS069D04- CCCCAGGTTAACCCCATTATTGGTCGGATAGAACGTAAAGCTGGACATGGAGCTGGACTC
rJMFF009I15+ CCCCAGGTTAACCCCATTATTGGTCGGATAGAACGTAAAGCTGGACATGGAGCTGGACTC
rJMSF025D22+ CCCCAGGTTAACCCCATTATTGGTCGGATAGAACGTAAAGCTGGACATGGAGCTGGACTC
rJMFF050I08+ CCCCAGGTTAACCCCATTATTGGTCGGATAGAACGTAAAGCTGGACATGGAGCTGGACTC
                      ____________________________________________________________
consensus CCCCAGGTTAACCCCATTATTGGTCGGATAGAACGTAAAGCTGGACATGGAGCTGGACTC
 
. : . : . : . : . : . :
JMFS069D04- CCAACGCAGAAAATGATTGATGAAGCTGTAGACCGGTATGCCTTCATGGCTAAGGTGATG
rJMFF009I15+ CCAACGCAGAAAATGATTGATGAAGCTGTAGACCGGTATGCCTTCATGGCTAAGGTGATG
rJMSF025D22+ CCAACGCAGAAAATGATTGATGAAGCTGTAGACCGGTATGCCTTCATGGCTAAGGTGATG
rJMFF050I08+ CCAACGGAGAAAATGATTGATGAAGCTGTAGACCGGTATGCCTTCATGGCTAAGGTGATG
                      ____________________________________________________________
consensus CCAACGCAGAAAATGATTGATGAAGCTGTAGACCGGTATGCCTTCATGGCTAAGGTGATG
 
. : . : . : . : . : . :
JMFS069D04- GGTGCAACCTGGATCGAGTAGATGTATGACCAATAGAACAAGAACTAGTAAAACTTCTTT
rJMFF009I15+ GGTGCAACCTGGATCGAGTAGATGTATGACCAATAGAACAAGAACTAGTAAAACTTCTTT
rJMSF025D22+ GGTGCAACCTGGATCGAGTAGATGTATGACCAATAGAACAAGAACTAGTAAAACTTCTTT
rJMFF050I08+ GGTGCAACCTGGATCGAGTAGATGTATGACCAATAGAACAAGAACTAGTAAAACTTCTTT
                      ____________________________________________________________
consensus GGTGCAACCTGGATCGAGTAGATGTATGACCAATAGAACAAGAACTAGTAAAACTTCTTT
 
. : . : . : . : . : . :
JMFS069D04- CACAAGTACTAATTCTTCTAAAGAATTGAGTTTATAGCAGTTTCTTGAGGTGTTGAGGAG
rJMFF009I15+ CACAAGTACTAATTCTTCTAAAGAATTGAGTTTATAGCAGTTTCTTGAGGTGTTGAGGAG
rJMSF025D22+ CACAAGTACTAATTCTTCTAAAGAATTGAGTTTATAGCAGTTTCTTGAGGTGTTGAGGAG
rJMFF050I08+ CACAAGTACTAATTCTTCTAAAGAATTGAGTTTATAGCAGTTTCTTGAGGTGTTGAGGAG
                      ____________________________________________________________
consensus CACAAGTACTAATTCTTCTAAAGAATTGAGTTTATAGCAGTTTCTTGAGGTGTTGAGGAG
 
. : . : . : . : . : . :
JMFS069D04- AGATTATGTTTTAATTGTGATTAGCTTCTCA
rJMFF009I15+ AGATTATGTTTTAATTGTGATTAGCTTCTCATTTATATATTTGGTTGGGGAAAACT
rJMSF025D22+ AGATTATGTTTTAATTGTGATTAGCTTCTCATTTATATATTTGGTTGGGGAAAACTGCCC
rJMFF050I08+ AGATTATGTTTTAATTGTGATTAGCTTCTCATTTATATATTTGGTTGGGGAAAACTGCCC
                      ____________________________________________________________
consensus AGATTATGTTTTAATTGTGATTAGCTTCTCATTTATATATTTGGTTGGGGAAAACTGCCC
 
. : . : . : . : . : . :
rJMSF025D22+ CTTAATTGCGCTT
rJMFF050I08+ CTTAATTGCGCTTTAAGATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus CTTAATTGCGCTTTAAGATAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG