Previous Contig 010999:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002P02Sequence740010999 (31)gb:TOBBY2A_17253673e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF006H20Sequence592010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.764010999 (31)gb:TOBBY2A_17253671e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF007K06Sequence593010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.740010999 (31)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF008N04Sequence547010546 (89)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.744010999 (31)gb:TOBBY2A_17253675e-78Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF008N15Sequence597010546 (89)gb:AY550990_1613318e-100Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.781010999 (31)gb:TOBBY2A_17253671e-86Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF013G22Sequence566010546 (89)gb:AY550990_16133184e-94Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.781010999 (31)gb:TOBBY2A_17253673e-87Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF019I17Sequence548010546 (89)gb:AY550990_16133181e-90Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.743010999 (31)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF019M03Sequence518010546 (89)gb:AF181492_17748527e-85Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.740010999 (31)gb:TOBBY2A_17253674e-82Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF023G06Sequence428010546 (89)gb:AF464925_18020289e-66Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.719010999 (31)gb:TOBBY2A_17253671e-71Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF023L05Sequence483010546 (89)gb:AY550990_16133182e-77Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.734010999 (31)gb:TOBBY2A_17253671e-82Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF023N07Sequence428010546 (89)gb:AF464925_18020289e-66Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.268010999 (31)
JMFF027H04Sequence516010546 (89)gb:AF181492_17748527e-85Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.728010999 (31)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF029I16Sequence592010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.739010999 (31)gb:TOBBY2A_17253671e-79Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF030E04Sequence535010546 (89)gb:AF181492_17748523e-88Lilium longiflorum elongation factor-1 alpha 3 mRNA, complete cds.170010999 (31)
JMFF035J23Sequence552010546 (89)gb:AY550990_16133189e-92Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.690010999 (31)gb:TOBBY2A_17253679e-68Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF036O03Sequence575010546 (89)gb:AY550990_16133187e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.715010999 (31)gb:TOBBY2A_17253672e-75Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF037J08Sequence552010546 (89)gb:AY550990_16133183e-91Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.363010999 (31)gb:AF281361_17829421e-18Saccharum officinarum elongation factor mRNA, complete cds.
JMFF037O10Sequence548010546 (89)gb:AY550990_16133183e-91Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.771010999 (31)gb:TOBBY2A_1725367e-102Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF039C05Sequence379010546 (89)gb:AF464925_18020283e-56Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.664010999 (31)gb:TOBBY2A_17253671e-62Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFF041G03Sequence650010546 (89)gb:AB019427_1514277e-111Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.502010999 (31)gb:AB019427_15142771e-30Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF041J02Sequence660010546 (89)gb:AB019427_1514277e-111Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.620010999 (31)gb:AB019427_15142771e-48Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF044L09Sequence640010546 (89)gb:AB019427_1514277e-110Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.592010999 (31)gb:AB019427_15142773e-50Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF050H22Sequence631010546 (89)gb:ZMU76259_1732225e-104Zea mays elongation factor 1-alpha (EF1-A) mRNA, complete cds.623010999 (31)gb:AB019427_15142772e-48Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.
JMFF050J22Sequence568010546 (89)gb:AY550990_16133182e-88Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.501010999 (31)gb:TOBBY2A_17253675e-24Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMFN037F20Sequence363010999 (31)sp|P29521|EF11_DAUCA1e-15Elongation factor 1-alpha (EF-1-alpha).>pir|S21989|S21989 translation elongation
JMFN041D17Sequence630010999 (31)gb:TOBBY2A_17253672e-68Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF001E08Sequence337010546 (89)gb:AF464925_18020283e-48Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.752010999 (31)gb:TOBBY2A_17253671e-77Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF007A14Sequence213010546 (89)gb:AF464925_18020285e-22Elaeis oleifera elongation factor 1-alpha mRNA, complete cds.749010999 (31)gb:TOBBY2A_17253673e-87Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF016F05Sequence550010546 (89)gb:AY550990_16133183e-91Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.780010999 (31)gb:TOBBY2A_17253672e-76Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF021E21Sequence596010546 (89)gb:AY550990_16133182e-99Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete cds.740010999 (31)gb:TOBBY2A_17253674e-82Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.
JMSF046J12Sequence736010546 (89)gb:AB019427_1514277e-127Nicotiana paniculata mRNA for elongation factor-1 alpha, complete cds.752010999 (31)gb:TOBBY2A_17253671e-80Nicotiana tabacum mRNA for elongation factor-1 alpha, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF037O10+ CNTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGTCCCC
                      ____________________________________________________________
consensus CNTTCAGGATGTGTACAAGATTGGTGGTATTGGTACTGTCCCC
 
. : . : . : . : . : . :
rJMFF037O10+ TGTGGGGTCGTGTGGAGACTGGTGTCCTGAAGCCGGGTATGGTTGTTACATTTGGACCTT
                      ____________________________________________________________
consensus TGTGGGGTCGTGTGGAGACTGGTGTCCTGAAGCCGGGTATGGTTGTTACATTTGGACCTT
 
. : . : . : . : . : . :
rJMFF037O10+ CTGGTCTTACCACNGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCAC
rJMFF023L05+ TACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCAC
rJMSF007A14+ ACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCAC
rJMSF001E08+ ACGAAGCCCTTCAGGAGGCAC
rJMSF021E21+ CACGAAGCCCTTCAGGAGGCAC
rJMFF013G22+ CCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCAC
rJMFF019M03+ CCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCAC
rJMFF008N15+ CCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCNTTCAGGAGGCAC
rJMSF046J12+ ACGAAGCCNTTCAGGAGGCAC
rJMFF029I16+ CAGGAGGCAC
rJMFF007K06+ CAGGAGGCAC
rJMFF002P02+ CAGGAGGCAC
rJMSF016F05+ CACTGAAGTTAAGTCTG-TGAAATGCACCACGAAGCCCTTCAGGAGGCAC
rJMFF019I17+ TTCAGGAGGCAC
rJMFF006H20+ CCACGAAGCCNTTCAGGAGGCAC
rJMFF008N04+ CAC
                      ____________________________________________________________
consensus CTGGTCTTACCACTGAAGTTAAGTCTGTTGAAATGCACCACGAAGCCCTTCAGGAGGCAC
 
. : . : . : . : . : . :
rJMFF037O10+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF023L05+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMSF007A14+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMSF001E08+ TTCCCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMSF021E21+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF013G22+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF019M03+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF008N15+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMSF046J12+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF029I16+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF036O03+ AATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF007K06+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF002P02+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMSF016F05+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF019I17+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF027H04+ CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
JMFN041D17- AGGATCTTAAGCG
rJMFF006H20+ TTCCCCGGTGACCAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF035J23+ CTTAAGCG
rJMFF008N04+ TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
rJMFF023G06+ GAAGAACGTTGCTGTGAAGGATCTTAAGCG
                      ____________________________________________________________
consensus TT-CCCGGTGA-CAATGTTGGATTCAATGTGAAGAACGTTGCTGTGAAGGATCTTAAGCG
 
. : . : . : . : . : . :
rJMFF037O10+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF023L05+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMSF007A14+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMSF001E08+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMSF021E21+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF013G22+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF019M03+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF008N15+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMSF046J12+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF029I16+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF036O03+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF007K06+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF002P02+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMSF016F05+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF019I17+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF027H04+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
JMFN041D17- TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF006H20+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF035J23+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF039C05+ CTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTN
rJMFF008N04+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
rJMFF023G06+ TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
                      ____________________________________________________________
consensus TGGTTATGTTGCCTCAAACTCTAAGGATGACCCAGCCAAAGGAGCTGCGAGCTTCACCTC
 
. : . : . : . : . : . :
rJMFF037O10+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF023L05+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMSF007A14+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMSF001E08+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMSF021E21+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF013G22+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF019M03+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF008N15+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMSF046J12+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF029I16+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF036O03+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF007K06+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF002P02+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMSF016F05+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF019I17+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF027H04+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
JMFN041D17- TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF044L09+ CAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF006H20+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF035J23+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF039C05+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF008N04+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF041J02+ TCATCATCATGAACCACCCTGGACAGATCGGT-ATGGATATGCTCCCGTGCTGGA
rJMFF023G06+ TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
rJMFF050H22+ GGTAATGGATATGCTCCCGTGCTGGA
                      ____________________________________________________________
consensus TCAGGTCATCATCATGAACCACCCTGGACAGATCGGTAATGGATATGCTCCCGTGCTGGA
 
. : . : . : . : . : . :
rJMFF037O10+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF023L05+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMSF007A14+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMSF001E08+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMSF021E21+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF013G22+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF019M03+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF008N15+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMSF046J12+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF029I16+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF036O03+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF007K06+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF002P02+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTTACCAAGATTGATAGACG
rJMSF016F05+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF019I17+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF027H04+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
JMFN041D17- CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF044L09+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF037J08+ TCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGNCG
JMFN037F20- ACTTTTGACCAAGATTGATAGACG
rJMFF006H20+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF035J23+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF039C05+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF008N04+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF041J02+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF023G06+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
rJMFF050H22+ CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
                      ____________________________________________________________
consensus CTGCCACACCTCCCACATTGCAGTCAAGTTTGCTGAACTTTTGACCAAGATTGATAGACG
 
. : . : . : . : . : . :
rJMFF037O10+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF023L05+ GTCTGGTAAGGAGCTGGAG-ATGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF007A14+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF001E08+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF021E21+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF013G22+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF019M03+ GTCTGGTAAGGAGCTGGAG-ATGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF008N15+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF046J12+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF029I16+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF036O03+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF007K06+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF002P02+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMSF016F05+ GTCTGGTAAGGAGCTGGAGAAGGAGCTCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF019I17+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF027H04+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
JMFN041D17- GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF044L09+ GTCTGGTAAGGAGCTGGAG-ATGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF037J08+ GTCTGGTAAGGAGCNGGAGAAGGAGCCCAAGTTCNTGAAGAATGGTGATGCTGGTATGGN
JMFN037F20- GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAACTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF006H20+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF035J23+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF039C05+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF008N04+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF041G03+ TGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF041J02+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF023G06+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
rJMFF050J22+ GAAGAATGGTGATGCTGGTATGGT
rJMFF050H22+ GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
                      ____________________________________________________________
consensus GTCTGGTAAGGAGCTGGAGAAGGAGCCCAAGTTCCTGAAGAATGGTGATGCTGGTATGGT
 
. : . : . : . : . : . :
rJMFF037O10+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF023L05+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMSF007A14+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMSF001E08+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMSF021E21+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF013G22+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF019M03+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF008N15+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMSF046J12+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF029I16+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCCGAGTACCCACCACTTGG
rJMFF036O03+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF007K06+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF002P02+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMSF016F05+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF019I17+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF027H04+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
JMFN041D17- GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF044L09+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF037J08+ GANGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCNTCTCTGAGTNCCCNCCACTTGG
JMFN037F20- GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGC
rJMFF006H20+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF035J23+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF039C05+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF008N04+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF041G03+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF041J02+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF023G06+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF050J22+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
rJMFF050H22+ GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
                      ____________________________________________________________
consensus GAAGATGCTTCCCACCAAGCCCATGGTTGTTGAAACCTTCTCTGAGTACCCACCACTTGG
 
. : . : . : . : . : . :
rJMFF037O10+ TCGTTTTGCTGTGGGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF023L05+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMSF007A14+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMSF001E08+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMSF021E21+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF013G22+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF019M03+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF008N15+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMSF046J12+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF029I16+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF036O03+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF007K06+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF030E04+ GCAGTTGNTGNTATCAAGAATGNTGG
rJMFF002P02+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMSF016F05+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF019I17+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF027H04+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
JMFN041D17- TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF044L09+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF037J08+ TCGTTNTGCTGTGAGGNACATGAGACAANCAGTTGCAGTTGGTGTTATCAAGAANGTTNA
JMFN037F20- TCGCTTTGATGTGAGGGACGGTACAC-AACAGTTGCCACTGGTGTTAACAAGAATGTTGA
rJMFF006H20+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF035J23+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF039C05+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF008N04+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF041G03+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF041J02+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF023G06+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF050J22+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
rJMFF050H22+ TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
                      ____________________________________________________________
consensus TCGTTTTGCTGTGAGGGACATGAGACAAACAGTTGCAGTTGGTGTTATCAAGAATGTTGA
 
. : . : . : . : . : . :
rJMFF037O10+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF023L05+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMSF007A14+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMSF001E08+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMSF021E21+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF013G22+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF019M03+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF008N15+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMSF046J12+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF029I16+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF036O03+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF007K06+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF023N07+ GAAGTGAGCATT
rJMFF030E04+ CANGAAGGATCCANCTGGTNCCAAGGTCACCAAGGNTGNCCANAAGAAGNAGTGAGCATT
rJMFF002P02+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMSF016F05+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF019I17+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF027H04+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
JMFN041D17- CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF044L09+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF037J08+ CAAGAAGGATCCANCTGGTNCCAAGGTCACCAAGGNTGCCCAGAAGAAGAAGTGAGCATT
JMFN037F20- CAAGAAGGATCCAACTGACGCCAAGGTCACCAAGGCTGCCCACAAGAAGAAGTGAGTATT
rJMFF006H20+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF035J23+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF039C05+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF008N04+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF041G03+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF041J02+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF023G06+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF050J22+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
rJMFF050H22+ CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
                      ____________________________________________________________
consensus CAAGAAGGATCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGAAGTGAGCATT
 
. : . : . : . : . : . :
rJMFF037O10+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF023L05+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMSF007A14+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMSF001E08+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMSF021E21+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF013G22+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF019M03+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF008N15+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMSF046J12+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF029I16+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF036O03+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF007K06+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF023N07+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF030E04+ TTNGGTNATGANATCATCCATNGAAGGAATTACTTATATTTGCGTTTG-TTNTTTTAAAT
rJMFF002P02+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMSF016F05+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF019I17+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF027H04+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
JMFN041D17- TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTANAT
rJMFF044L09+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF037J08+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGNTTG-TTTTTTTAAAT
JMFN037F20- TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGCTTGCCTTTTTTAAAT
rJMFF006H20+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF035J23+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF039C05+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF008N04+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF041G03+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF041J02+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF023G06+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF050J22+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
rJMFF050H22+ TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
                      ____________________________________________________________
consensus TTTGCTAATGAGATCATCCATTGAAGGAATTACTTATATTTGCGTTTG-TTTTTTTAAAT
 
. : . : . : . : . : . :
rJMFF037O10+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF023L05+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMSF007A14+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMSF001E08+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMSF021E21+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF013G22+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF019M03+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF008N15+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMSF046J12+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF029I16+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF036O03+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF007K06+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF023N07+ TTTATCAGACATTTTTACTAGTTNTGGAATTGGCTCCAGAGTTGGTNTGAATCTCTTGGC
rJMFF030E04+ NTNATCAGACATNTTTANTAGTTT
rJMFF002P02+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMSF016F05+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF019I17+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF027H04+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
JMFN041D17- TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF044L09+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF037J08+ TTTATCAGACATTT
JMFN037F20- TTACTCACACATTTTTACTAGTCTTGGAATTGGCTCCAGA
rJMFF006H20+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF035J23+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF039C05+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF008N04+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF041G03+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF041J02+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF023G06+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF050J22+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
rJMFF050H22+ TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
                      ____________________________________________________________
consensus TTTATCAGACATTTTTACTAGTTTTGGAATTGGCTCCAGAGTTGGTTTGAATCTCTTGGC
 
. : . : . : . : . : . :
rJMFF037O10+ ACAATGTGCTC
rJMFF023L05+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMSF007A14+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMSF001E08+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMSF021E21+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF013G22+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF019M03+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF008N15+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMSF046J12+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF029I16+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF036O03+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF007K06+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF023N07+ ACAATGTNCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTNNTAGANGAGCTA
rJMFF002P02+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMSF016F05+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF019I17+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF027H04+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
JMFN041D17- ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF044L09+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF006H20+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF035J23+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF039C05+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF008N04+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF041G03+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF041J02+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF023G06+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF050J22+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
rJMFF050H22+ ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
                      ____________________________________________________________
consensus ACAATGTGCTCTGCTATGGAATTTTTCTGGATGTCATTTGTAGTGTTGTTAGATGAGCTA
 
. : . : . : . : . : . :
rJMFF023L05+ CAGTTGGTGTCAATT-TTGTGCGAGT
rJMSF007A14+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCAT
rJMSF001E08+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMSF021E21+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTC
rJMFF013G22+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF019M03+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTG
rJMFF008N15+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMSF046J12+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF029I16+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF036O03+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF007K06+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF023N07+ CAGTTGGTGTCAATTATTGTGCGAGTNTACAACTGCCCTAGGCATTGTGCTTNTCACATC
rJMFF002P02+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMSF016F05+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF019I17+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF027H04+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
JMFN041D17- CAGTTGGTGTCAATT-TTG
rJMFF044L09+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCAC
rJMFF006H20+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF035J23+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF039C05+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF008N04+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF041G03+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF041J02+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF023G06+ CAGTTGGTGTCAATT-TTGTGCGAGTTTT-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF050J22+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
rJMFF050H22+ CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
                      ____________________________________________________________
consensus CAGTTGGTGTCAATT-TTGTGCGAGTTTA-AACTGCCCTAGGCATTGTGCTTTTCACATC
 
. : . : . : . : . : . :
rJMSF001E08+ -TTGAAGAATTCAAGT
rJMFF013G22+ -TTGAAGAATTCAAGT
rJMFF008N15+ -TTGAAGAATTCAAGT
rJMSF046J12+ -TTGAAGAATTCAAGTT
rJMFF029I16+ -TTGAAGAATTCAAG
rJMFF036O03+ -TTGAAGAAT
rJMFF007K06+ -TTGAAGAATTCAAGT
rJMFF023N07+ -TTGAAGAATTCAAG
rJMFF002P02+ -TTGAAGAATTCAAGT
rJMSF016F05+ -TTGAAGAATTCAAGTT
rJMFF019I17+ -TTGAAGAATTCAAGTT
rJMFF027H04+ -TTGAAGAATTCAAGTTTTAATTA
rJMFF006H20+ TTTGAAGAATTCAAGTTTTAATTA
rJMFF035J23+ TTTGAAGAATTCAAGTTTTAATTAT
rJMFF039C05+ TTTGAAGAATTCAAGTTTTAATTAT
rJMFF008N04+ TTTGAAGAATTCAAGTTTTAATTATC
rJMFF041G03+ TTTGAAGAATTCAAGTTTTAATTATCTT
rJMFF041J02+ TTTGAAGAATTCAAGTTTTAATTATCTTT
rJMFF023G06+ TTTGAAGAATTCAAGTTTTAATTATCTTTATC
rJMFF050J22+ TTTGAAGAATTCAAGTTTTAATTATCTTTATCCTAGTTGTTGTTTTGCCCCACA
rJMFF050H22+ TTTGAAGAATTCAAGTTTTAATTATCTTTATCCTAGTTATTGTTTTGCCCCACAGCACAG
                      ____________________________________________________________
consensus -TTGAAGAATTCAAGTTTTAATTATCTTTATCCTAGTTGTTGTTTTGCCCCACAGCACAG