Previous Contig 010998:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009D04Sequence554006803 (11)gb:AY064138_15660194e-10Arabidopsis thaliana At1g07510/F22G5_9 mRNA, complete cds.>gb:AY124808_1580173 A742010998 (6)gb:AY064138_15660195e-72Arabidopsis thaliana At1g07510/F22G5_9 mRNA, complete cds.>gb:AY124808_1580173 A
JMFF034P23Sequence288006803 (11)gb:BT002743_16363465e-05Arabidopsis thaliana clone C104832 putative AAA-type ATPase (At2g29080) mRNA, co654010998 (6)gb:AF397903_17958831e-64Pisum sativum AAA-metalloprotease FtsH (FTSH) mRNA, complete cds; nuclear gene f
JMFF050H15Sequence636006803 (11)gb:AY064138_15660193e-15Arabidopsis thaliana At1g07510/F22G5_9 mRNA, complete cds.>gb:AY124808_1580173 A626010998 (6)gb:AF397903_17958831e-48Pisum sativum AAA-metalloprotease FtsH (FTSH) mRNA, complete cds; nuclear gene f
JMFS069A07Sequence618010998 (6)gb:AP003240_1826034e-100Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF032D11Sequence684006803 (11)gb:AF397903_17958832e-26Pisum sativum AAA-metalloprotease FtsH (FTSH) mRNA, complete cds; nuclear gene f834010998 (6)gb:AY064138_15660192e-97Arabidopsis thaliana At1g07510/F22G5_9 mRNA, complete cds.>gb:AY124808_1580173 A
JMSF053G09Sequence671006803 (11)gb:AY064138_15660196e-24Arabidopsis thaliana At1g07510/F22G5_9 mRNA, complete cds.>gb:AY124808_1580173 A902010998 (6)gb:AC105770_1738221e-113Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_D02, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF053G09+ ACCCTGATAACTATGGACCATTTTTGAGTC
                      ____________________________________________________________
consensus ACCCTGATAACTATGGACCATTTTTGAGTC
 
. : . : . : . : . : . :
rJMSF053G09+ AGCAATAGATAGGGTAATTGGTGGTCTTGAGAAGAAGAACAAGGTCATAAGCAAGCTGGA
                      ____________________________________________________________
consensus AGCAATAGATAGGGTAATTGGTGGTCTTGAGAAGAAGAACAAGGTCATAAGCAAGCTGGA
 
. : . : . : . : . : . :
rJMSF032D11+ AAGGAGAACAGNTGCTTACCATGNATCTGGCCATGCAGTTGCTGGTTNGTTCTTGGAACA
JMFS069A07- AAGGAGAACAGTTGCTTACCATGAATCTGGCCATGCAGTTGCTGGTTGGTTCTTGGAACA
rJMSF053G09+ AAGGAGAACAGTTGCTTACCATGAATCTGGCCATGCAGTTGCTGGTTGGTTCTTGGAACA
                      ____________________________________________________________
consensus AAGGAGAACAGTTGCTTACCATGAATCTGGCCATGCAGTTGCTGGTTGGTTCTTGGAACA
 
. : . : . : . : . : . :
rJMSF032D11+ TGCAGAACCATTGCTCAAAGTGACAATTGTTCCACGTGGTACTGCAGCCCTTGGGTTTGC
JMFS069A07- TGCAGAACCATTGCTCAAAGTGACAATTGTTCCACGTGGTACTGCAGCCCTTGGGTTTGC
rJMSF053G09+ TGCAGAACCATTGCTCAAAGTGACAATTGTTCCACGTGGTACTGCAGCCCTTGGGTTTGC
rJMFF009D04+ TTGC
                      ____________________________________________________________
consensus TGCAGAACCATTGCTCAAAGTGACAATTGTTCCACGTGGTACTGCAGCCCTTGGGTTTGC
 
. : . : . : . : . : . :
rJMSF032D11+ TCAATATGTTCCTAATGAAAATCTTTTGATGACAAAAGAACAACTCTTTGATATGACATG
rJMFF034P23+ TGACAAAAGAACAACTCTTTGATATGACATG
JMFS069A07- TCAATATGTTCCTAATGAAAATCTTTTGATGACAAAAGAACAACTCTTTGATATGACATG
rJMSF053G09+ TCAATATGTTCCTAATGAAAATCTTTTGATGACAAAAGAACAACTCTTTGATATGACATG
rJMFF009D04+ TCAATATGTTCCTAATGAAAATCTTTTGATGACAAAAGAACAACTCTTTG--ATGACATG
                      ____________________________________________________________
consensus TCAATATGTTCCTAATGAAAATCTTTTGATGACAAAAGAACAACTCTTTGATATGACATG
 
. : . : . : . : . : . :
rJMSF032D11+ CATGACACTTGGTGGTCGAGCATCTGAGCAGGTTATGCTGGGGAAGATATCTACAGGAGC
rJMFF034P23+ CATGACACTTGGTGGTCGAGCATCTGAGCAGGTTATGCTGGGGAAGATATCTACAGGAGC
JMFS069A07- CATGACACTTGGTGGTCGAGCATCTGAGCAGGTTATGCTGGGGAAGATATCTACAGGAGC
rJMSF053G09+ CATGACACTTGGTGGTCGAGCATCTGAGCAGGTTATGCTGGGGAAGATATCTACAGGAGC
rJMFF009D04+ CATGACACTTGGTGGTCGAGCATCTGAGCAGGTTATGCTGGGGAAGATATCTACAGGAGC
                      ____________________________________________________________
consensus CATGACACTTGGTGGTCGAGCATCTGAGCAGGTTATGCTGGGGAAGATATCTACAGGAGC
 
. : . : . : . : . : . :
rJMSF032D11+ ACAGAATGATTTGGAGAAAGTCACCAAGA-TGACATATGCCCAAGTGGCAGTGTATGGTT
rJMFF034P23+ ACAGAATGATCTGGAGAAAGTCACCAAGANTGACATATGCCCAAGTGGCAGTGTATGGTT
JMFS069A07- ACAGAATGATTTGGAGAAAGTCACCAAGA-TGACATATGCCCAAGTGGCAGTGTATGGTT
rJMSF053G09+ ACAGAATGATTTGGAGAAAGTCACCAAGA-TGACATATGCCCAAGTGGCAGTGTATGGTT
rJMFF009D04+ ACAGAATGATTTGGAGAAAGTCACCAAGA-TGACATATGCCCAAGTGGCAGTGTATGGTT
rJMFF050H15+ ATATGCCCAAGTGGCAGTGTATGGTT
                      ____________________________________________________________
consensus ACAGAATGATTTGGAGAAAGTCACCAAGA-TGACATATGCCCAAGTGGCAGTGTATGGTT
 
. : . : . : . : . : . :
rJMSF032D11+ TCAGTGACAAGGTTGGTCTGCTTTCCTTCCCTCCAAATGAAAATGCATTTGAGATGAGCA
rJMFF034P23+ TCAGTGACAAGGTTGGTCTGCTTTCCTTCCCTCCAAATGAAAATGCATTTGAGATGAGCA
JMFS069A07- TCAGTGACAAGGTTGGTCTGCTTTCCTTCCCTCCAAATGAAAATGCATTTGAGATGAGCA
rJMSF053G09+ TCAGTGACAAGGTTGGTCTGCTTTCCTTCCCTCCAAATGAAAATGCATTTGAGATGAGCA
rJMFF009D04+ TCAGTGACAAGGTTGGTCTGCTTTCCTTCCCTCCAAATGAAAATGCATTTGAGATGAGCA
rJMFF050H15+ TCAGTGACAAGGTTGGTCTGCTTTCTTTCCCTCCAAATGAAAATGCATTGNAGATGAGCA
                      ____________________________________________________________
consensus TCAGTGACAAGGTTGGTCTGCTTTCCTTCCCTCCAAATGAAAATGCATTTGAGATGAGCA
 
. : . : . : . : . : . :
rJMSF032D11+ AGCCTTACAGCAACAAAACTGCTGCCATCATTGACAATGAAGTTAGAGAATGGATTGCAA
rJMFF034P23+ AGCCTTACAGCAACAAAACTGCTGCCATCATTNACAATGAAGTTAGAGAATGGATTGCAA
JMFS069A07- AGCCTTACAGCAACAAAACTGCTGCCATCATTGACAATGAAGTTAGAGAATGGATTGCAA
rJMSF053G09+ AGCCTTACAGCAACAAAACTGCTGCCATCATTGACAATGAAGTTAGAGAATGGATTGCAA
rJMFF009D04+ AGCCTTACAGCAACAAAACTGCTGCCATCATTGACAATGAAGTTAGAGAATGGATTGCAA
rJMFF050H15+ AGCCTTACAGCAACAAAACTGCTGCCATCATTGACAATGAAGTTAGAGAATGGATTGCAA
                      ____________________________________________________________
consensus AGCCTTACAGCAACAAAACTGCTGCCATCATTGACAATGAAGTTAGAGAATGGATTGCAA
 
. : . : . : . : . : . :
rJMSF032D11+ AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
rJMFF034P23+ AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
JMFS069A07- AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
rJMSF053G09+ AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
rJMFF009D04+ AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
rJMFF050H15+ AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
                      ____________________________________________________________
consensus AGGCTTATGAATGCACAGTCCAGCTCATAGAGGAGCACAAGGAGCATGTAGCTCAGATTG
 
. : . : . : . : . : . :
rJMSF032D11+ CTGAATTGTTACTTGAGAAGGGGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
rJMFF034P23+ CTGAATTGTTACTTGAGAAGGAGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
JMFS069A07- CTGAATTGTTACTTGAGAAGGAGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
rJMSF053G09+ CTGAATTGTTACTTGAGAAGGAGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
rJMFF009D04+ CTGAATTGTTACTTGAGAAGGAGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
rJMFF050H15+ CTGAATTGTTACTTGAGAAGGAGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
                      ____________________________________________________________
consensus CTGAATTGTTACTTGAGAAGGAGGTCTTGCATCAAGAGGATTTGGTTCGGGTACTCGGCG
 
. : . : . : . : . : . :
rJMSF032D11+ AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTAG
rJMFF034P23+ AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTAG
JMFS069A07- AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTA
rJMSF053G09+ AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTAG
rJMFF009D04+ AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTAG
rJMFF050H15+ AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTAG
                      ____________________________________________________________
consensus AACGCCCATTCAAGAGTAGTGAGCCCACAAATTACGATAGGTTCAAGGATGGATTTGTAG
 
. : . : . : . : . : . :
rJMSF032D11+ AAGACAAAGAAACTGAAGCTAAAGATACAGCTGAGAATAAGAGTACAAAGGATGATGACT
rJMFF034P23+ AAGACAAAGAAACTGAAGCTAAAGATACAGCTGAGAATAAGAGTACAAAGGATGANGACT
rJMSF053G09+ AAGACAAAGAAACTGAAGCTAAAGATACAGCTGAGAATAAGAGTACAAAGGATGATGACT
rJMFF009D04+ AAGACAAAGAAACTGAAGCTAAAGATACAGCTGAGAATAAGAGTACAAAGGATGATGACT
rJMFF050H15+ AAGACAAAGAAACTGAAGCTAAAGATACAGCTGAGAATAAGAGTACAAAGGATGATGACT
                      ____________________________________________________________
consensus AAGACAAAGAAACTGAAGCTAAAGATACAGCTGAGAATAAGAGTACAAAGGATGATGACT
 
. : . : . : . : . : . :
rJMSF032D11+ CGTCACCTCTCCAGCCAGAGGTTGTTCCTGTATAGTCTATTGTGACTTGTAAGTGAGATC
rJMFF034P23+ CGTCACCTCTCCAGCCAGAGGTTGTTCCTGTATAGTCTATTGTGACTTGTAAGTGAGATC
rJMSF053G09+ CGTCACCTCTCCAGCCAGAGGTTGTTCCTGTATAGTCTATTGTGACTTGTAAGTGAGATC
rJMFF009D04+ CGTCACCTCTCCAGCCAGAGGTTGTTCCTGTATAGTCTATTGTGACTTGTAAGTGAGATC
rJMFF050H15+ CGTCACCTCTCCAGCCAGAGGTTGTTCCTGTATAGTCTATTGTGACTTGTAAGTGAGATC
                      ____________________________________________________________
consensus CGTCACCTCTCCAGCCAGAGGTTGTTCCTGTATAGTCTATTGTGACTTGTAAGTGAGATC
 
. : . : . : . : . : . :
rJMSF032D11+ ATTGAGGTATCTTTGATATTTGCCTACTCTGCACTCACTGAAGTTATATAAACTATCAAT
rJMFF034P23+ ATTGAGGTATCTTTGATATTTGCCTACTCTGCACTCACTGAAGTTATATAAACTATCAAT
rJMSF053G09+ ATTGAGGTATCTTTGATATTTGCCTACTCTGCACTCACTGAAGTTATATAAACTATCAAT
rJMFF009D04+ ATTGAGGTATCTTTGATATTTGCCTACTCTGCACTCACTGAAGTTATATAAACTATCAAT
rJMFF050H15+ ATTGAGGTATCTTTGATATTTGCCTACTCTGCACTCACTGAAGTTATATAAACTATCAAT
                      ____________________________________________________________
consensus ATTGAGGTATCTTTGATATTTGCCTACTCTGCACTCACTGAAGTTATATAAACTATCAAT
 
. : . : . : . : . : . :
rJMSF032D11+ CCAGCT
rJMFF034P23+ CCAGCTATCAATNACAAGCAAGT
rJMSF053G09+ CCAGCTATCAATGACAAGCAAGTTTGGAGTTTT
rJMFF009D04+ CCAGCTATCAATGACAAGCAAGTTTGGAGTTTTTGCATGGTATTATACTATTACTCGTAA
rJMFF050H15+ CCAGCTATCAATGACAAGCAAGTTTGGAGTTTTTGCATGGTATTATACTATTACTCGTAA
                      ____________________________________________________________
consensus CCAGCTATCAATGACAAGCAAGTTTGGAGTTTTTGCATGGTATTATACTATTACTCGTAA
 
. : . : . : . : . : . :
rJMFF009D04+ CAAATAAAAA-GAAAAAACAAA
rJMFF050H15+ CAAATAAAAATGAAAAAACAAATCTATTTGCCTAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus CAAATAAAAATGAAAAAACAAATCTATTTGCCTAAAAAAAAAAAAAAAACTCTCCAGGGT