Previous Contig 010995:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050H11Sequence578002157 (2)631010995 (2)gb:AC133859_17415301e-09Oryza sativa chromosome 3 BAC OSJNBa0075A22 genomic sequence, complete sequence.
JMSF011G22Sequence255002157 (2)719010995 (2)gb:AE005172_8910345e-11Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC069251_154073

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011G22+ CCCCGGCATCCAAAAGGGCTGTGCTC
                      ____________________________________________________________
consensus CCCCGGCATCCAAAAGGGCTGTGCTC
 
. : . : . : . : . : . :
rJMSF011G22+ TCCGTTGGCACTCATTTGTGGGGGTTCCAAGTCGCCTTCTTCGTGCCCCATCCACAATGC
                      ____________________________________________________________
consensus TCCGTTGGCACTCATTTGTGGGGGTTCCAAGTCGCCTTCTTCGTGCCCCATCCACAATGC
 
. : . : . : . : . : . :
rJMSF011G22+ CCCTTGTGGAGACGACAGTCAATTTTGCTTGTTAAGGAGCAACTGTGTGAAGCCTCTTGT
                      ____________________________________________________________
consensus CCCTTGTGGAGACGACAGTCAATTTTGCTTGTTAAGGAGCAACTGTGTGAAGCCTCTTGT
 
. : . : . : . : . : . :
rJMSF011G22+ GGACTCCATCACTGATAAGGACACCAGTGTCCAAATCGCAGCACTGGAAGCTCTTTCCAC
rJMFF050H11+ GTCCAAATCGCAGCACTGGAAGCTCTTTCCAC
                      ____________________________________________________________
consensus GGACTCCATCACTGATAAGGACACCAGTGTCCAAATCGCAGCACTGGAAGCTCTTTCCAC
 
. : . : . : . : . : . :
rJMSF011G22+ TCTATTGTTGGATACCTCTAGTGGCTCTAAGCGGGCTATTGAGGAGCTCGAACGCCTCGG
rJMFF050H11+ TCTATGTTGGGATACCTCTAGTGGCTCTAAGCGGGCTATTGAGGAGCTCGAACGCCTCGG
                      ____________________________________________________________
consensus TCTATTTTTGGATACCTCTAGTGGCTCTAAGCGGGCTATTGAGGAGCTCGAACGCCTCGG
 
. : . : . : . : . : . :
rJMSF011G22+ TGTGGTGAGCTCTGTGGTTTCGCTCTTCACACAAGCTCGACCAGGGGAGCTTCAAGAGAG
rJMFF050H11+ TGTGGTGAGCTCTGTGGTTTCGCTCTTCACACAAGCTCGACCAGGGGAGCTTCAAGAGAG
                      ____________________________________________________________
consensus TGTGGTGAGCTCTGTGGTTTCGCTCTTCACACAAGCTCGACCAGGGGAGCTTCAAGAGAG
 
. : . : . : . : . : . :
rJMSF011G22+ GACTATTTGGATGGTCGAAAGGATCCTGAGAGTCGAGAGCTTTACTCAACAGCATTCGCT
rJMFF050H11+ GACTATTTGGATGGTCGAAAGGATCCTGAGAGTCGAGAGCTTTACTCAACAGCATTCGCT
                      ____________________________________________________________
consensus GACTATTTGGATGGTCGAAAGGATCCTGAGAGTCGAGAGCTTTACTCAACAGCATTCGCT
 
. : . : . : . : . : . :
rJMSF011G22+ AAACCAGTCCCTGGTTAAAGCTTTGGTGGATGCATTTAAGCATGGGAACGCCATCACAAA
rJMFF050H11+ AAACCAGTCCCTGGTTAAAGCTTTGGTGGATGCATTTAAGCATGGGAACGCCATCACAAA
                      ____________________________________________________________
consensus AAACCAGTCCCTGGTTAAAGCTTTGGTGGATGCATTTAAGCATGGGAACGCCATCACAAA
 
. : . : . : . : . : . :
rJMSF011G22+ GAGGCACGCGCAAGACGCTCTTACTAACCTGAAGCAAATATCCGGGACCAGTGGAAAGAC
rJMFF050H11+ GAGGCACGCGCAAGACGCTCTTACTAACCTGAAGCAAATATCCGGGACCAGTGGAAAGAC
                      ____________________________________________________________
consensus GAGGCACGCGCAAGACGCTCTTACTAACCTGAAGCAAATATCCGGGACCAGTGGAAAGAC
 
. : . : . : . : . : . :
rJMSF011G22+ ATCGAGCCAAAACCGGGGAAGGAGGTAGCGATTAGCACCTCGAGACTTGACAGAGAACTT
rJMFF050H11+ ATCGAGCCAAAACCGGGGAAGGAGGTAGCGATTAGCACCTCGAGACTTGACAGAGAACTT
                      ____________________________________________________________
consensus ATCGAGCCAAAACCGGGGAAGGAGGTAGCGATTAGCACCTCGAGACTTGACAGAGAACTT
 
. : . : . : . : . : . :
rJMSF011G22+ GTGCATCAGTTCACCAAGTAACTCTCTTATCCTTCTCTAAATGTTTCACTTATTCATTGA
rJMFF050H11+ GTGCATCAGTTCACCAAGTAACTCTCTTATCCTTCTCTAAATGTTTCACTTATTCATTGA
                      ____________________________________________________________
consensus GTGCATCAGTTCACCAAGTAACTCTCTTATCCTTCTCTAAATGTTTCACTTATTCATTGA
 
. : . : . : . : . : . :
rJMSF011G22+ TTGTTCAAAGTATATTCCCAAATCCCAAATCATAAAACTTCAGGTTTCTGTAAATGTCTG
rJMFF050H11+ TTGTTCAAAGTATATTCCCAAATCCCAAATCATAAAACTTCAGGTTTCTGTAAATGTCTG
                      ____________________________________________________________
consensus TTGTTCAAAGTATATTCCCAAATCCCAAATCATAAAACTTCAGGTTTCTGTAAATGTCTG
 
. : . : . : . : . : . :
rJMSF011G22+ ACAAAACGATTTCAACTATGACCAGTTATACTT
rJMFF050H11+ ACAAAACGATTTCAACTATGA-CAGTTATACTTTAGTACAGGATGCATTTTAATGACTAA
                      ____________________________________________________________
consensus ACAAAACGATTTCAACTATGACCAGTTATACTTTAGTACAGGATGCATTTTAATGACTAA
 
. : . : . : . : . : . :
rJMFF050H11+ TTCAGTAGATTGTGGTGGTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTCAGTAGATTGTGGTGGTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG