Previous Contig 010993:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006M13Sequence639010993 (9)gb:AB010071_15108883e-61Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560
JMFF020L23Sequence531002154 (5)gb:AB010071_15108882e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560776010993 (9)gb:ART223803_15420702e-69Arabidopsis thaliana mRNA for 2-oxoglutarate dehydrogenase E2 subunit.
JMFF027D07Sequence613010993 (9)gb:ART223803_15420702e-71Arabidopsis thaliana mRNA for 2-oxoglutarate dehydrogenase E2 subunit.
JMFF037I03Sequence593002154 (5)gb:AB010071_15108887e-27Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560804010993 (9)gb:ART223803_15420706e-72Arabidopsis thaliana mRNA for 2-oxoglutarate dehydrogenase E2 subunit.
JMFF050G18Sequence608002154 (5)gb:AB010071_15108883e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560571010993 (9)gb:BT000926_16351813e-37Arabidopsis thaliana clone C105123 putative dihydrolipoamide succinyltransferase
JMFN003O22Sequence644010993 (9)gb:ART223803_15420702e-64Arabidopsis thaliana mRNA for 2-oxoglutarate dehydrogenase E2 subunit.
JMFS146H08Sequence626010993 (9)gb:BT000926_16351812e-47Arabidopsis thaliana clone C105123 putative dihydrolipoamide succinyltransferase
JMSF009N16Sequence695010993 (9)gb:ART223803_15420701e-69Arabidopsis thaliana mRNA for 2-oxoglutarate dehydrogenase E2 subunit.
JMSF046K15Sequence764002154 (5)gb:AB010071_15108881e-44Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560792010993 (9)gb:AB010071_15108881e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY042897_1560

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027D07+ TTTATTAAAGCTGCAGTTAGTGCACTCCAGAATCAG-CCAATAGTTA
rJMSF046K15+ GCTGCAGTTAGTGCACTCCAGAATCAGCCCAATAGTTA
rJMFF006M13+ GAATCAG-CCAATAGTTA
rJMFF020L23+ AAGCTGCAGTTAGTGCACTCCAGAATCAG-CCAATAGTTA
rJMSF009N16+ GCTGCAGTTAGTGCACTCCAGAATCAG-CCAATAGTTA
rJMFF037I03+ GCTGCAGTTAGTGCACTCCAGAATCAG-CCAATAGTTA
                      ____________________________________________________________
consensus TTTATTAAAGCTGCAGTTAGTGCACTCCAGAATCAG-CCAATAGTTA
 
. : . : . : . : . : . :
rJMFF027D07+ ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
JMFN003O22- CATCAGTATAGCTG
rJMSF046K15+ ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
rJMFF006M13+ ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
rJMFF020L23+ ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
rJMSF009N16+ ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
rJMFF037I03+ ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
                      ____________________________________________________________
consensus ATGCAGTGATTGATGGTGATGACATTATATATAGAGACTACATAGACATCAGTATAGCTG
 
. : . : . : . : . : . :
rJMFF027D07+ TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
JMFN003O22- TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
rJMSF046K15+ TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
rJMFF006M13+ TTGGCACCCCAAAGGGCCNTTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
rJMFF020L23+ TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
rJMSF009N16+ TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
rJMFF037I03+ TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
                      ____________________________________________________________
consensus TTGGCACCCCAAAGGGCC-TTGTTGTCCCAGTTATCCGCGATGCTGAGAAGATGAACTTT
 
. : . : . : . : . : . :
rJMFF027D07+ GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
JMFN003O22- GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
rJMSF046K15+ GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
rJMFF006M13+ GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
rJMFF020L23+ GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
rJMSF009N16+ GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
rJMFF037I03+ GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
JMFS146H08+ CTAAAAAGGCTAATGACGGAAGTATATCT
                      ____________________________________________________________
consensus GCTGATATAGAAAAGACAATTAATGCACTGGCTAAAAAGGCTAATGACGGAAGTATATCT
 
. : . : . : . : . : . :
rJMFF027D07+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
JMFN003O22- ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
rJMSF046K15+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
rJMFF006M13+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
rJMFF020L23+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
rJMSF009N16+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
rJMFF037I03+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
JMFS146H08+ ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
rJMFF050G18+ GATATCAAATGGTGGTGTTTATGGAAGTCTT
                      ____________________________________________________________
consensus ATTGATGAGATGGCTGGCGGATCATTCACGATATCAAATGGTGGTGTTTATGGAAGTCTT
 
. : . : . : . : . : . :
rJMFF027D07+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
JMFN003O22- CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
rJMSF046K15+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
rJMFF006M13+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
rJMFF020L23+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
rJMSF009N16+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
rJMFF037I03+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
JMFS146H08+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
rJMFF050G18+ CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
                      ____________________________________________________________
consensus CTGAGTACCCCCATCATCAATCCGCCTCAGTCTGCCATCCTGGGCATGCACTCAATTGTG
 
. : . : . : . : . : . :
rJMFF027D07+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
JMFN003O22- AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
rJMSF046K15+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
rJMFF006M13+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
rJMFF020L23+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
rJMSF009N16+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
rJMFF037I03+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
JMFS146H08+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
rJMFF050G18+ AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
                      ____________________________________________________________
consensus AACCGTCCAATGGTCGTCGGAGGCAACATTGTTTCTAGACCAATGATGTACATTGCCTTG
 
. : . : . : . : . : . :
rJMFF027D07+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
JMFN003O22- ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
rJMSF046K15+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
rJMFF006M13+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
rJMFF020L23+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
rJMSF009N16+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
rJMFF037I03+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
JMFS146H08+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
rJMFF050G18+ ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
                      ____________________________________________________________
consensus ACTTACGATCATAGGCTGATTGATGGAAGAGAGGCAGTGTTCTTTTTGAGAAGGATTAAA
 
. : . : . : . : . : . :
rJMFF027D07+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
JMFN003O22- GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
rJMSF046K15+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
rJMFF006M13+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
rJMFF020L23+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
rJMSF009N16+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
rJMFF037I03+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
JMFS146H08+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
rJMFF050G18+ GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
                      ____________________________________________________________
consensus GATGTGGTTGAAGATCCTCGCCGCTTGCTCCTTGACATATGATTTCGGAGCTTGGTTTGA
 
. : . : . : . : . : . :
rJMFF027D07+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
JMFN003O22- TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
rJMSF046K15+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
rJMFF006M13+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
rJMFF020L23+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
rJMSF009N16+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
rJMFF037I03+ TTACGTATATTCCTGATTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
JMFS146H08+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
rJMFF050G18+ TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
                      ____________________________________________________________
consensus TTACGTATATTCCTGAGTTGGTATTTTGAGTTGGTATTTTACTCAAATCTTGAGCAAGAA
 
. : . : . : . : . : . :
rJMFF027D07+ GAATAAATGTACTGATTCCAAAGTTTTG
JMFN003O22- GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
rJMSF046K15+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
rJMFF006M13+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
rJMFF020L23+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
rJMSF009N16+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
rJMFF037I03+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
JMFS146H08+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
rJMFF050G18+ GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
                      ____________________________________________________________
consensus GAATAAATGTACTGATTCCAAAGTTTTGTAGGGTTTCATAATTATTGCGTTGATCGTAAA
 
. : . : . : . : . : . :
JMFN003O22- TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACANATTTCT
rJMSF046K15+ TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACAAATTTCT
rJMFF006M13+ TTATGGGTTGCGGCT
rJMFF020L23+ TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTG-TTTTTTAACAAATTTCT
rJMSF009N16+ TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACAAATTTC
rJMFF037I03+ TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACAAATTTCT
JMFS146H08+ TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACAAATTTCT
rJMFF050G18+ TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACAAATTTCT
                      ____________________________________________________________
consensus TTATGGGTTGCGGCTAGAACACACATGGACTGAGCCCCCTTGTTTTTTTAACAAATTTCT
 
. : . : . : . : . : . :
JMFN003O22- AGCCGCTGTCATGCAGGGGCTCTATTGCTTT
rJMSF046K15+ AGCCGCTGTCATGCAGGGGCTCTATTGCTTTTGTTACGCTGGAGAATGCGTTGCCTGCGT
rJMFF020L23+ AGCCGCTGTCATGCAGGGGCTCTATTGCTTTTGTTACGCTGGAGAATGCGTTGCCTGCGT
rJMFF037I03+ AGCCGCTGTCATGCAGGGGCTCTATTGCTTTTGTTACGCTGGAGAATGCGTTGCCTGCGT
JMFS146H08+ AGCCGCTGTCATGCAGGGGCTCTATTGCTTTTGTTACGCTGGAGAATGCGTTGCCTGCGT
rJMFF050G18+ AGCCGCTGTCATGCAGGGGCTCTATTGCTTTTGTTACGCTGGAGAATGCGTTGCCTGCGT
                      ____________________________________________________________
consensus AGCCGCTGTCATGCAGGGGCTCTATTGCTTTTGTTACGCTGGAGAATGCGTTGCCTGCGT
 
. : . : . : . : . : . :
rJMSF046K15+ TCTTCTGAAATATACCAAT
rJMFF020L23+ TCTTCTGAAATATACCAAT
rJMFF037I03+ TCTTCTGAAATATACCAATTTCATTTGTGTTTTA
JMFS146H08+ TCTTCTGAAATATACCAATTTCATTTGTGTTTTA
rJMFF050G18+ TCTTCTGAAATATACCAATTTCATTTGTGTTTTATTTATATTTTATTTATGCTTCTCTGC
                      ____________________________________________________________
consensus TCTTCTGAAATATACCAATTTCATTTGTGTTTTATTTATATTTTATTTATGCTTCTCTGC