Previous Contig 010991:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003D02Sequence541003915 (29)gb:AC010852_15371412e-40Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence706010991 (11)gb:BT002074_16356774e-86Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFF015K22Sequence499003915 (29)gb:AC010852_15371418e-38Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence454010991 (11)gb:BT002074_16356775e-54Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFF016E17Sequence472003915 (29)gb:AC010852_15371411e-30Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence782010991 (11)gb:BT002074_16356773e-94Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFF048O14Sequence389003915 (29)gb:AC010852_15371414e-22Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence244010991 (11)gb:BT002074_16356771e-05Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFF050G11Sequence646003915 (29)gb:AC010852_15371415e-49Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence634010991 (11)gb:BT002074_16356771e-70Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFS030G10Sequence564010991 (11)gb:BT002074_16356772e-80Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFS051H08Sequence594010991 (11)gb:BT002074_16356775e-86Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMFS156E07Sequence629010991 (11)gb:BT002074_16356774e-87Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMSF003H03Sequence381004514 (2)gb:AY087649_15726784e-15Arabidopsis thaliana clone 37341 mRNA, complete sequence.743010991 (11)gb:BT002074_16356774e-96Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:
JMSF004M03Sequence358004641 (3)128010991 (11)gb:AP004587_18419531e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P054
JMSF016D15Sequence396003915 (29)gb:AC010852_15371412e-05Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence824010991 (11)gb:BT002074_1635677e-108Arabidopsis thaliana putative aminopeptidase (At1g63770) mRNA, complete cds.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS051H08- GACATGATGACTGTTGCTGACCCGGAT
JMFS030G10- GACATGATGACTGTTGCTGACCCGGAT
rJMSF016D15+ GGACATGATGACTGTTGCTGACCCGGAT
                      ____________________________________________________________
consensus GGACATGATGACTGTTGCTGACCCGGAT
 
. : . : . : . : . : . :
rJMSF003H03+ AAGGCAGAC
JMFS051H08- GCCGTTCATGCTGTTAGAACCTTCCTCAGAAAGCAACTTGCGTCTGAGTTGAAGGCAGAC
JMFS030G10- GCCGTTCATGCTGTTAGAACCTTCCTCAGAAAGCAACTTGCGTCTGAGTTGAAGGCAGAC
rJMSF016D15+ GCCGTTCATGCTGTTAGAACCTTCNTCAGAAAGCAACCTGCGTCTGAGTTGAAGGCAGAC
                      ____________________________________________________________
consensus GCCGTTCATGCTGTTAGAACCTTCCTCAGAAAGCAACTTGCGTCTGAGTTGAAGGCAGAC
 
. : . : . : . : . : . :
rJMSF003H03+ CTTCTCAGAACGGTCAAAGAGAATAAGAGCTNTGAACNATACGAGTTTAATCATCACAAT
JMFS051H08- CTTCTCAGAACGGTCAAAGAGAATAAGAGCTCTGAACAATACGAGTTTAATCATCACAAT
JMFS030G10- CTTCTCAGAACGGTCAAAGAGAATAAGAGCTCTGAACAATACGAGTTTAATCATCACAAT
rJMSF016D15+ CTTCTCAGAACGGTCAAAGAGAATAAGAGCTCTGAACAATACGAGTTTAATCATCACAAT
JMFS156E07- GAACAATACGAGTTTAATCATCACAAT
rJMFF016E17+ AAGAGAATAAGAGCTCTGAACAATACGAGTTTAATCATCACAAT
                      ____________________________________________________________
consensus CTTCTCAGAACGGTCAAAGAGAATAAGAGCTCTGAACAATACGAGTTTAATCATCACAAT
 
. : . : . : . : . : . :
rJMSF003H03+ ATGNCAA-GGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTNGAAGATCC
JMFS051H08- ATGGCAA-GGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
JMFS030G10- ATGGCAA-GGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
rJMSF016D15+ ATGGCAA-GGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
rJMFF003D02+ AAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
JMFS156E07- ATGGCAAGGGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
rJMFF016E17+ ATGGCAA-GGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
                      ____________________________________________________________
consensus ATGGCAA-GGCGTTCTCTAAAAAATATTGCTCTTGGATATCTCGGGTCGCTTGAAGATCC
 
. : . : . : . : . : . :
rJMSF003H03+ AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
JMFS051H08- AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
JMFS030G10- AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
rJMSF016D15+ AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAGTT
rJMFF003D02+ AGAAATTACGGAGCTTATATNGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
JMFS156E07- AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
rJMFF016E17+ AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
                      ____________________________________________________________
consensus AGAAATTACGGAGCTTATATTGCATGAATATAAAACTGCAACAAATATGACAGAGCAATT
 
. : . : . : . : . : . :
rJMSF003H03+ TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
JMFS051H08- TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
JMFS030G10- TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
rJMSF016D15+ TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
rJMFF003D02+ TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
JMFS156E07- TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
rJMFF016E17+ TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
rJMFF050G11+ AGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
                      ____________________________________________________________
consensus TGCTGCTCTGGTAGCTATTGACCAGCAGCCTGGCAAAACGCGTGATGATGTTTTGGCTGA
 
. : . : . : . : . : . :
rJMSF003H03+ TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
JMFS051H08- TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
JMFS030G10- TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
rJMSF016D15+ TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
rJMFF015K22+ G
rJMFF003D02+ TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
JMFS156E07- TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
rJMFF016E17+ TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
rJMFF050G11+ TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
                      ____________________________________________________________
consensus TTTCTACGGGAAGTGGCAGCACGACTTCTTGGTGGTAAATAAATGGTTTAGCCTCCAAGG
 
. : . : . : . : . : . :
rJMSF003H03+ TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
JMFS051H08- TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
JMFS030G10- TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
rJMSF016D15+ TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
rJMFF015K22+ TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
rJMFF003D02+ TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
JMFS156E07- TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
rJMFF016E17+ TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
rJMFF050G11+ TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
                      ____________________________________________________________
consensus TGTGTCAGCCATTCCCGGGAATGTTGAAAATGTCAGTAGACTTTTGACCCACCCGGCCTT
 
. : . : . : . : . : . :
rJMSF003H03+ CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
JMFS051H08- CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
JMFS030G10- CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
rJMSF016D15+ CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
rJMFF015K22+ CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
rJMFF003D02+ CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
JMFS156E07- CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
rJMFF016E17+ CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
rJMFF050G11+ CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
                      ____________________________________________________________
consensus CGACCTTCGCAATCCGAACAAGGTGTATGCGTTGATTGGGGGATTTTGCGGGTCCCCTAT
 
. : . : . : . : . : . :
rJMSF003H03+ TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
JMFS051H08- TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
JMFS030G10- TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAA
rJMSF016D15+ TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
rJMFF015K22+ TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
rJMFF003D02+ TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
JMFS156E07- TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
rJMFF016E17+ TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
rJMFF050G11+ TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
                      ____________________________________________________________
consensus TAACTTCCATGCGAAGGATGGGTCGGGCTACAAATTCTTAGGAGAACTTGTTGTACAACT
 
. : . : . : . : . : . :
rJMSF003H03+ TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
JMFS051H08- TGACAAACTAAACCCCCAGGTGGCTTCT
rJMSF016D15+ TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
rJMFF015K22+ TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
rJMSF004M03+ TAGGCGGAGGCG
rJMFF003D02+ TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
JMFS156E07- TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
rJMFF016E17+ TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
rJMFF050G11+ TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
                      ____________________________________________________________
consensus TGACAAACTAAACCCCCAGGTGGCTTCTCGTATGGTATCCGCCTTCTCTAGGTGGAGGCG
 
. : . : . : . : . : . :
rJMSF003H03+ TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
rJMSF016D15+ TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
rJMFF015K22+ TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
rJMSF004M03+ NTATGATGAANCCAGCCAAGCTCTCGNCAAGGCGCAGTNGNAGCTNATCTTGTCCACCGA
rJMFF003D02+ TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
JMFS156E07- TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
rJMFF016E17+ TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
rJMFF048O14+ CTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
rJMFF050G11+ TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
                      ____________________________________________________________
consensus TTATGATGAAACCAGGCAAGCTCTTGCCAAGGCGCAGTTGGAGATGATCTTGTCCACCGA
 
. : . : . : . : . : . :
rJMSF003H03+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
rJMSF016D15+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
rJMFF015K22+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
rJMSF004M03+ GNGGCTCTCGGAGAACGTGTTTGAAATCCCATCGAAGAGCCNGGCTGCTTGATT
rJMFF003D02+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
JMFS156E07- GGGGCTCTCGGAGAACGTGNTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
rJMFF016E17+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
rJMFF048O14+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
rJMFF050G11+ GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
                      ____________________________________________________________
consensus GGGGCTCTCGGAGAACGTGTTTGAAATCGCATCGAAGAGCTTGGCTGCTTGATTATTTTC
 
. : . : . : . : . : . :
rJMSF003H03+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATNT
rJMSF016D15+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
rJMFF015K22+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
rJMFF003D02+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
JMFS156E07- TC
rJMFF016E17+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
rJMFF048O14+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
rJMFF050G11+ TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
                      ____________________________________________________________
consensus TCCAAGAACTAAAAGTTAAACTTGCATTGTTATAACCTGCTAAATCATGTGCAAAGATTT
 
. : . : . : . : . : . :
rJMSF003H03+ CAAGCTCCCCAAAAA
rJMSF016D15+ CAAGCTCCCCAAAAACT
rJMFF015K22+ CAAGCTCCCCAAAAACTGGTGAATAGTTTATAA
rJMFF003D02+ CAAGCTCCCCAAAAACTGGTGAATAGTTTATAATGATGAATTTATGGGATTCAAACAGCA
rJMFF016E17+ CAAGCTCCCCAAAAACTGGTGAATAGTTTATAATGATGAATTTATGGGATTCAAACAGCA
rJMFF048O14+ CAAGCTCCCCAAAAACTGGTGAATAGTTTATAATGATGAATTTATGGGATTCAAACAGCA
rJMFF050G11+ CAAGCTCCCCAAAAACTGGTGAATAGTTTATAATGATGAATTTATGGGATTCAAACAGCA
                      ____________________________________________________________
consensus CAAGCTCCCCAAAAACTGGTGAATAGTTTATAATGATGAATTTATGGGATTCAAACAGCA
 
. : . : . : . : . : . :
rJMFF003D02+ A
rJMFF016E17+ A
rJMFF048O14+ A
rJMFF050G11+ ATTTTATTTTCATXXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATTTTATTTTCATNNNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAGG