Previous Contig 010988:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011P13Sequence516000629 (8)pir|T10174|T101741e-41hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown736010988 (9)pir|T10174|T101742e-57hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF014M05Sequence521000629 (8)pir|T10174|T101744e-42hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown778010988 (9)pir|T10174|T101742e-56hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF020K02Sequence342000629 (8)pir|T10174|T101741e-14hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown682010988 (9)pir|T10174|T101745e-42hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF032N01Sequence448000629 (8)pir|T10174|T101742e-30hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown730010988 (9)pir|T10174|T101742e-47hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF046P16Sequence449000629 (8)pir|T10174|T101742e-30hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown472010988 (9)pir|T10174|T101741e-11hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFF047I14Sequence439000629 (8)pir|T10174|T101742e-28hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown361010988 (9)
JMFF050G04Sequence577000629 (8)pir|T10174|T101742e-50hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown414010988 (9)
JMFN013O20Sequence535010988 (9)pir|T10174|T101744e-21hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown
JMFN018B01Sequence601010988 (9)pir|T10174|T101747e-78hypothetical protein - castor bean>gb:RCUNKN_1703416 R.communis mRNA for unknown

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018B01- CGCTCTACCCTCCTAGACCTACTAATGTGAACTTGGTAAAGAACGCGGA
                      ____________________________________________________________
consensus CGCTCTACCCTCCTAGACCTACTAATGTGAACTTGGTAAAGAACGCGGA
 
. : . : . : . : . : . :
JMFN018B01- TTTCGAGGAGGGTCCATACTTGTTCGCGAACGTGACAACCGGCGTTCTTTGCCCGCCCTT
                      ____________________________________________________________
consensus TTTCGAGGAGGGTCCATACTTGTTCGCGAACGTGACAACCGGCGTTCTTTGCCCGCCCTT
 
. : . : . : . : . : . :
JMFN018B01- CATCGAGGACGACCACTCTCCCATCCCGGCGTGGACGGTGGACTCTCTGAAAGCCGTGAA
rJMFF011P13+ TGGACGGTGGACTCTCTGAAAGCCGTGAA
rJMFF014M05+ TGGACGGTGGACTCTCTGAAAGCCGTGAA
                      ____________________________________________________________
consensus CATCGAGGACGACCACTCTCCCATCCCGGCGTGGACGGTGGACTCTCTGAAAGCCGTGAA
 
. : . : . : . : . : . :
JMFN018B01- GTACATAGACGCGGAGCATTTCTCGGTGCCCCACGGCAGGAGAGCCGTGGAACTGGTGGC
rJMFF011P13+ GTACATAGACGCGGAGCATTTCTCGGTGCCCCACGGCAGGAGAGCCGTGGAACTGGTGGC
rJMFF020K02+ GC
rJMFF014M05+ GTACATAGACGCGGAGCATTTCTCGGTGCCCCACGGCAGGAGAGCCGTGGAACTGGTGGC
rJMFF032N01+ CGGTGCCCCACGGCAGGAGAGCCGTGGAACTGGTGGC
                      ____________________________________________________________
consensus GTACATAGACGCGGAGCATTTCTCGGTGCCCCACGGCAGGAGAGCCGTGGAACTGGTGGC
 
. : . : . : . : . : . :
JMFN018B01- CGGGAAAGAGAGCGCCATCGCTCAAATCACCAGAACAATTGTGGGCAAAATTTACGACCT
rJMFF011P13+ CGGGAAAGAGAGCGCCATCGCTCAAATCACCAGAACAATTGTGGGCAAAATTTACGACCT
rJMFF020K02+ CGGGAAAGAGAGCGCCATCGCTCAAATCACCAGAACAATTGTGGGCAAAATTTACGACCT
rJMFF014M05+ CGGGAAAGAGAGCGCCATCGCTCAAATCACCAGAACAATTGTGGGCAAAATTTACGACCT
rJMFF032N01+ CGGGAAAGAGAGCGCCATCGCTCAAATCACCAGAACAATTGTGGGCAAAATTTACGACCT
                      ____________________________________________________________
consensus CGGGAAAGAGAGCGCCATCGCTCAAATCACCAGAACAATTGTGGGCAAAATTTACGACCT
 
. : . : . : . : . : . :
JMFN018B01- CACGTTCCTGGTGGGAGACGCCAGCAACTCGTGCGAGGGCTCCATGATCGTGGAGGCGTT
rJMFF011P13+ CACGTTCCTGGTGGGAGACGCCAGCAACTCGTGCGAGGGCTCCATGATCGTGGAGGCGTT
rJMFF020K02+ CACGTTCCTGGTGGGAGACGCCAGCAACTCGTGCGAGGGCTCCATGATCGTGGAGGCGTT
rJMFF014M05+ CACGTTCCTGGTGGGAGACGCCAGCAACTCGTGCGAGGGCTCCATGATCGTGGAGGCGTT
rJMFF032N01+ CACGTTCCTGGTGGGAGACGCCAGCAACTCGTGCGAGGGCTCCATGATCGTGGAGGCGTT
                      ____________________________________________________________
consensus CACGTTCCTGGTGGGAGACGCCAGCAACTCGTGCGAGGGCTCCATGATCGTGGAGGCGTT
 
. : . : . : . : . : . :
JMFN018B01- CGCCGGGCAGTCCACGCTCAAAGTCCCCTACGATTCCAAGGGCAAGGGCGGATTTAAACC
rJMFF011P13+ CGCCGGGCAGTCCACGCTCAAAGTCCCCTACGAGTCCAAGGGCAAGGGCGGATTTAAACC
rJMFF020K02+ CGCCGGGCAGTCCACGCTCAAAGTCCCCTACGAGTCCAAGGGCAAGGGCGGATTTAAACC
JMFN013O20- GCAGTCCACGCTCAAAGTCCCCTACGAGTCCAAGGGCAAGGGCGGATTTAAACC
rJMFF014M05+ CGCCGGGCAGTCCACGCTCAAAGTCCCCTACGAGTCCAAGGGCAAGGGCGGATTTAAACC
rJMFF032N01+ CGCCGGGCAGTCCACGCTCAAAGTCCCCTACGAGTCCAAGGGCAAGGGCGGATTTAAACC
                      ____________________________________________________________
consensus CGCCGGGCAGTCCACGCTCAAAGTCCCCTACGAGTCCAAGGGCAAGGGCGGATTTAAACC
 
. : . : . : . : . : . :
JMFN018B01- GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
rJMFF011P13+ GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
rJMFF020K02+ GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
JMFN013O20- GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
rJMFF046P16+ CCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
rJMFF014M05+ GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
rJMFF032N01+ GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
                      ____________________________________________________________
consensus GGCCAAACTCCGGTTCAAGGCCACCGCTAACAGAACCAGGATTATGTTCTTCAGCACATA
 
. : . : . : . : . : . :
JMFN018B01- CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
rJMFF011P13+ CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
rJMFF020K02+ CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
JMFN013O20- CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTTTTGACCACGTCAG
rJMFF046P16+ CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
rJMFF014M05+ CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
rJMFF032N01+ CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
                      ____________________________________________________________
consensus CTACCATACACGAAGCGATGACTTTGTCTCACTCTGTGGCCCCGTTGTTGACCACGTCAG
 
. : . : . : . : . : . :
JMFN018B01- GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTNTCG
rJMFF011P13+ GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
rJMFF020K02+ GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
JMFN013O20- GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
rJMFF046P16+ GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
rJMFF014M05+ GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
rJMFF032N01+ GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
rJMFF050G04+ CAGTGTTTGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
                      ____________________________________________________________
consensus GCTTCTCAGTGTTCGTCATCCCAATTTTCTCCCTTAAATTCAATCCATATATAATTTTCG
 
. : . : . : . : . : . :
JMFN018B01- ATTATACTATAT
rJMFF011P13+ ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
rJMFF020K02+ ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
JMFN013O20- ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
rJMFF046P16+ ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
rJMFF014M05+ ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
rJMFF032N01+ ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
rJMFF047I14+ GAAGATATATCCATTTTACTTCCCCCAATTTCTGTTATTG
rJMFF050G04+ ATTATACTATATATGAAGATGAAGATATATCAATTTTTCTTCCCCAAATACTGTTTATTG
                      ____________________________________________________________
consensus ATTATACTATATATGAAGATGAAGATATATCAATTTTACTTCCCCAAATACTGTTTATTG
 
. : . : . : . : . : . :
rJMFF011P13+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
rJMFF020K02+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
JMFN013O20- AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
rJMFF046P16+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
rJMFF014M05+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
rJMFF032N01+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
rJMFF047I14+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
rJMFF050G04+ AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
                      ____________________________________________________________
consensus AACCAGAGATCGTGCGGATATATATGGATTTTTGTTGTAATATGAAGCGAGGAGATCGAT
 
. : . : . : . : . : . :
rJMFF011P13+ GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
rJMFF020K02+ GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
JMFN013O20- GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
rJMFF046P16+ GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
rJMFF014M05+ GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
rJMFF032N01+ GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
rJMFF047I14+ GGAGAAAGTTTGTCTTCCCTCATAGTATGCATGCATGATATTTCTAACTACTACTATAGG
rJMFF050G04+ GGAGAAAGTTTGTCTTCCCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
                      ____________________________________________________________
consensus GGAGAAAGTTTGTCTTACCTCATAGTATGCATGCATGATATTACTAACTACTACTATATG
 
. : . : . : . : . : . :
rJMFF011P13+ AATACTTCTATTTATATATATGCATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
rJMFF020K02+ AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
JMFN013O20- AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
rJMFF046P16+ AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
rJMFF014M05+ AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
rJMFF032N01+ AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
rJMFF047I14+ AATACTTCTATTTATATATATGTAGGACTCTCTAGGGGAAGTCAATATATAGTATTATGT
rJMFF050G04+ AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
                      ____________________________________________________________
consensus AATACTTCTATTTATATATATGTATGACTCTCTAGTGGAAGTCAATATATAGTATTATGT
 
. : . : . : . : . : . :
rJMFF011P13+ ATATTGTGATGGGTACGTGTTGAATGGTAATT
rJMFF020K02+ ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
JMFN013O20- ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
rJMFF046P16+ ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
rJMFF014M05+ ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
rJMFF032N01+ ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
rJMFF047I14+ ATATTGTGATGGGTACGGGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
rJMFF050G04+ ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
                      ____________________________________________________________
consensus ATATTGTGATGGGTACGTGTTGAATGGTAATTTGTTGAAATAATAATTATATACTTCGAT
 
. : . : . : . : . : . :
rJMFF020K02+ CAATGAATGTTTGTAATATT
JMFN013O20- C
rJMFF046P16+ C
rJMFF014M05+ CAATGAATGTTTGTAATATTTCGAGTG
rJMFF032N01+ CAATGAATGTTTGTAATATTTCGAGTG
rJMFF047I14+ CAAAGAATGTTTGTAATATTTCGAGTGTGATACGGGAAAATCCTTTGTCGTAG
rJMFF050G04+ CAATGAATGTTTGTAATATTTCGAGTGTGATACGGGAAAATCCTTTGTCGTAGTTTTTCG
                      ____________________________________________________________
consensus CAATGAATGTTTGTAATATTTCGAGTGTGATACGGGAAAATCCTTTGTCGTAGTTTTTCG