Previous Contig 010986:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009O18Sequence615010986 (6)pir|T49947|T499471e-37hypothetical protein F8M21.10 - Arabidopsis thaliana>gb:ATF8M21_1551250 Arabidop755010986 (6)gb:AY084237_15693291e-32Arabidopsis thaliana clone 100590 mRNA, complete sequence.>gb:BT003127_1636708 A
JMFF013O19Sequence579010986 (6)pir|T49947|T499471e-34hypothetical protein F8M21.10 - Arabidopsis thaliana>gb:ATF8M21_1551250 Arabidop766010986 (6)gb:AY084237_15693292e-46Arabidopsis thaliana clone 100590 mRNA, complete sequence.>gb:BT003127_1636708 A
JMFF050F23Sequence602010986 (6)pir|T49947|T499471e-37hypothetical protein F8M21.10 - Arabidopsis thaliana>gb:ATF8M21_1551250 Arabidop574010986 (6)gb:AY084237_15693297e-05Arabidopsis thaliana clone 100590 mRNA, complete sequence.>gb:BT003127_1636708 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050F23- G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFF050F23- GCGGTTCTTTTGATGCCCAAATCATGTTTTTCTGAGTTCTCCTGATCCGTCTTGAATTAC
JMFF013O19- GCGGTTCTTTTGATGCCCAAATCATGTTTTTCTGAGTTCTCCTGATCCGTCTTGAATTAC
JMFF009O18- GCGGTTCTTTTGATGCCCAAATCATGTTTTTCTGAGTTCTCCTGATCCGTCTTGAATTAC
                      ____________________________________________________________
consensus GCGGTTCTTTTGATGCCCAAATCATGTTTTTCTGAGTTCTCCTGATCCGTCTTGAATTAC
 
. : . : . : . : . : . :
JMFF050F23- CCATCCCTAAAGTTTTCCGCTTTTTGAATTCTTCCGGGAAAAAAAATCGGAATTTTTTTT
JMFF013O19- CCATCCCTAAAGTTTTCCGCTTTTTGAATTCTTCCGGAAAAAAAAATCGGAATTTTTTTT
JMFF009O18- CCATCCCTAAAGTTTTCCGCTTTTTGAATTCTTCCGGGAAAAAAAATCGGAATTTTTTTT
                      ____________________________________________________________
consensus CCATCCCTAAAGTTTTCCGCTTTTTGAATTCTTCCGGGAAAAAAAATCGGAATTTTTTTT
 
. : . : . : . : . : . :
JMFF050F23- GCGTTTTGGATGCTGGATGGCAATGGGGGTTGACAAAAATGCTAGTGATCGGAAAGGAAA
JMFF013O19- GCGTTTTGGATGCTGGATGGCAATGGGGGTTGACAAAAATGCTAGTGATCGGAAAGGAAA
JMFF009O18- GCGTTTTGGATGCTGGATGGCAATGGGGGTTGACAAAAATGCTAGTGATCGGAAAGGAAA
                      ____________________________________________________________
consensus GCGTTTTGGATGCTGGATGGCAATGGGGGTTGACAAAAATGCTAGTGATCGGAAAGGAAA
 
. : . : . : . : . : . :
JMFF050F23- GAGCGTCGAGCCCAGTAAACACCGGAGAGGGCAGCAGAGGAGAGTCATGGCGGTTCAGAA
JMFF013O19- GAGCGTCGAGCCCAGTAAACACCGGAGAGGGCAGCAGAGGAGAGTCATGGCGGTTCAGAA
JMFF009O18- GAGCGTCGAGCCCAGTAAACACCGGAGAGGGCAGCAGAGGAGAGTCATGGCGGTTCAGAA
                      ____________________________________________________________
consensus GAGCGTCGAGCCCAGTAAACACCGGAGAGGGCAGCAGAGGAGAGTCATGGCGGTTCAGAA
 
. : . : . : . : . : . :
JMFF050F23- TCTCTACGAGACTTGCCGGGAAGTGTTTGCGAATTGCGGCCCAGACATCGTCCCGTCGCC
JMFF013O19- TCTCTACGAGACTTGCCGGGAAGTGTTTGCGAATTGCGGCCCANACATCGTCCCGTCGCC
JMFF009O18- TCTCTACGAGACTTGCCGGGAAGTGTTTGCGAATTGCGGCCCAGACATCGTCCCGTCGCC
                      ____________________________________________________________
consensus TCTCTACGAGACTTGCCGGGAAGTGTTTGCGAATTGCGGCCCAGACATCGTCCCGTCGCC
 
. : . : . : . : . : . :
JMFF050F23- GGAGAATGTCGAACGGGTTAAAGCTATTTTGGATAAAATGACGGGGATGGATGTTGGTCT
JMFF013O19- GGAGAATGTCGAACGGGTTAAAGCTATTTTGGATAAAATGACGGGGATGGATGTTGGTCT
JMFF009O18- GGAGAATGTCGAACGGGTTAAAGCTATTTTGGATAAAATGACGGGGATGGATGTTGGTCT
                      ____________________________________________________________
consensus GGAGAATGTCGAACGGGTTAAAGCTATTTTGGATAAAATGACGGGGATGGATGTTGGTCT
 
. : . : . : . : . : . :
JMFF050F23- CAGGCCGACCATGCCATACTTCAAGCCAACCATGCCATATTTCAAGCCAACCAGAAACGA
JMFF013O19- CAGGCCGACCATGCCATACTTCAAGCCAACCATGCCATATTTCAAGCCAACCAGAAACGA
JMFF009O18- CAGGCCGACCATGCCATACTTCAAGCCAACCATGCCATATTTCAAGCCAACCAGAAACGA
                      ____________________________________________________________
consensus CAGGCCGACCATGCCATACTTCAAGCCAACCATGCCATATTTCAAGCCAACCAGAAACGA
 
. : . : . : . : . : . :
JMFF050F23- TAGGCCTCCTGAAATCGCTTACATGCGCATCCATGAGTGTGATAAATTCTCGATAGGGAT
JMFF013O19- TAGGCCTCCTGAAATCGCTTACATGCGCATCCATGAGTGTGATAAATTCTCGATAGGGAT
JMFF009O18- TAGGCCTCCTGAAATCGCTTACATGCGCATCCATGAGTGTGATAAATTCTCGATAGGGAT
                      ____________________________________________________________
consensus TAGGCCTCCTGAAATCGCTTACATGCGCATCCATGAGTGTGATAAATTCTCGATAGGGAT
 
. : . : . : . : . : . :
JMFF050F23- CTTCTGTTTGCCACCGAAAGCCGTTATTCCTCTCCACAACCATCCTGGAATGACGGTTTT
JMFF013O19- CTTCTGTTTGCCACCGAAAGCCGTTATTCCTCTCCACAACCATCCTGGAATGACGGTTTT
JMFF009O18- CTTCTGTTTGCCACCGAAAGCCGTTATTCCTCTCCACAACCATCCTGGAATGACGGTTTT
rJMFF013O19+ CTGTTTGCCACCGAAAGCCGTTATTCNTCTCCACAACCATCCTGGAATGACGGTTTT
                      ____________________________________________________________
consensus CTTCTGTTTGCCACCGAAAGCCGTTATTCCTCTCCACAACCATCCTGGAATGACGGTTTT
 
. : . : . : . : . : . :
JMFF050F23- CAGCAAAATTCTTTTTGGAAAAATGCACGTACAGTCCTATGACTGGGCGGATGCTGGCCC
JMFF013O19- CAGCAAAATTCTTTTTGGAAAAATGCACGTACAGTCCTA
JMFF009O18- CAGCAAAATTCTTTTTGGAAAAATGCACGTACAGTCCTATGACTGGGCGGATGCTGGCCC
rJMFF013O19+ CAGCAAAATTCTTTTTGGAAAAATGCACGTACAGTCCTATGACTGGGCGGATGCTGGCCC
rJMFF009O18+ AATGCACGTACAGTCCTATGACTGGGCGGATGCTGGCCC
                      ____________________________________________________________
consensus CAGCAAAATTCTTTTTGGAAAAATGCACGTACAGTCCTATGACTGGGCGGATGCTGGCCC
 
. : . : . : . : . : . :
JMFF050F23- T
JMFF009O18- TGGTGGTAATGGCAA
rJMFF013O19+ TGGTGGTAATGGCAATCCCGATGGAGTTCGTTTGGCAAAAGTGAAGGTGAACTCGGAGTT
rJMFF009O18+ TGGTGGTAATGGCAATCCCGATGGAGTTCGTTTGGCAAAAGTGAAGGTGAACTCGGAGTT
                      ____________________________________________________________
consensus TGGTGGTAATGGCAATCCCGATGGAGTTCGTTTGGCAAAAGTGAAGGTGAACTCGGAGTT
 
. : . : . : . : . : . :
rJMFF013O19+ CAGTGCCCCTTGCGAGACTAACCTCCTCTACCCCAATGATTGTAACATGCACTGCTTCAG
rJMFF009O18+ CAGTGCCCCTTGCGAGACTAACCTCCTCTACCCCAATGATTGTAACATGCACTGCTTCAG
                      ____________________________________________________________
consensus CAGTGCCCCTTGCGAGACTAACCTCCTCTACCCCAATGATTGTAACATGCACTGCTTCAG
 
. : . : . : . : . : . :
rJMFF013O19+ GGCATTGACAGCTTGTGCCTTTCTCGATGTGGTCGTCCCGCCTTACAATGACCTCGAAGG
rJMFF009O18+ GGCATTGACAGCTTGTGCCTTTCTCGATGTGGTCGTCCCGCCTTACAATGACCTCGAAGG
                      ____________________________________________________________
consensus GGCATTGACAGCTTGTGCCTTTCTCGATGTGGTCGTCCCGCCTTACAATGACCTCGAAGG
 
. : . : . : . : . : . :
rJMFF013O19+ TCGCCATTGTCAGTATTACGTCGACTACCCTTTTGCCAACTTCTCAGATGAAGGTGCAAC
rJMFF009O18+ TCGCCATTGTCAGTATTACGTCGACTACCCTTTTGCCAACTTCTCAGATGAAGGTGCAAC
rJMFF050F23+ ACCCTTTTGCCAACTTCTCAGATGAAGGTGCAAC
                      ____________________________________________________________
consensus TCGCCATTGTCAGTATTACGTCGACTACCCTTTTGCCAACTTCTCAGATGAAGGTGCAAC
 
. : . : . : . : . : . :
rJMFF013O19+ AGGGCCCGAGGTGGCTGAGGATCAGAAGGAAAGCTATGTATGGCTCAAAGAGCGGGAGGT
rJMFF009O18+ AGGGCCCGAGGTGGCTGAGGATCAGAAGGAAAGCTGTGTATGGCTCAAAGAGCGGGAGGT
rJMFF050F23+ AGGGCCCGAGGTGGCTGAGGATCAGAAGGAAAGCTATGTATGGCTCAAAGAGCGGGAGGT
                      ____________________________________________________________
consensus AGGGCCCGAGGTGGCTGAGGATCAGAAGGAAAGCTATGTATGGCTCAAAGAGCGGGAGGT
 
. : . : . : . : . : . :
rJMFF013O19+ GCCCGAAGACTTGAAATTTGTCGGGGCATTGTACAATGGACCGAAATTAGTGAAGTGAGA
rJMFF009O18+ GCCCGAAGACTTGAAATTTGTCGGGGCATTGTACAATGGACCGAAATTAGTGAAGTGAGA
rJMFF050F23+ GCCCGAAGACTTGAAATTTGTCGGGGCATTGTACAATGGACCGAAATTAGTGAAGTGAGA
                      ____________________________________________________________
consensus GCCCGAAGACTTGAAATTTGTCGGGGCATTGTACAATGGACCGAAATTAGTGAAGTGAGA
 
. : . : . : . : . : . :
rJMFF013O19+ GCTAATCCATCACCAAACGAAGCTGGTTTCTGGCTTAACTGGAGCACAAAAACATCGGTC
rJMFF009O18+ GCTAATCCATCACCAAACGAAGCTGGTTTCTGGCTTAACTGGAGCACAAAAACATCGGTC
rJMFF050F23+ GCTAATCCATCACCAAACGAAGCTGGTTTCTGGCTTAACTGGAGCACAAAAACATCGGTC
                      ____________________________________________________________
consensus GCTAATCCATCACCAAACGAAGCTGGTTTCTGGCTTAACTGGAGCACAAAAACATCGGTC
 
. : . : . : . : . : . :
rJMFF013O19+ TTTCTTTCAATTTTAAGTCGCGGGTAGATAAAGAGAAGAGAATATAGATGGGAGGGGAGA
rJMFF009O18+ TTTCTTTCAATTTTAAGTCGCGGGTAGATAAAGAGAAGAGAATATAGATGGGAGGGGAGA
rJMFF050F23+ TTTCTTTCAATTTTAAGTCGCGGGTAGATAAAGAGAAGAGAATATAGATGGGAGGGGAGA
                      ____________________________________________________________
consensus TTTCTTTCAATTTTAAGTCGCGGGTAGATAAAGAGAAGAGAATATAGATGGGAGGGGAGA
 
. : . : . : . : . : . :
rJMFF013O19+ AATCTTCAGTTATAGCAGTGGGTGTACATAATGAGGCTATTAAAGGGACAGAAAACCATT
rJMFF009O18+ AATCTTCAGTTATAGCAGTGGGTGTACATAATGAGGCTATTAAAGGGACAGAAAACCATT
rJMFF050F23+ AATCTTCAGTTATAGCAGTGGGTGTACATAATGAGGCTATTAAAGGGACAGAAAACCATT
                      ____________________________________________________________
consensus AATCTTCAGTTATAGCAGTGGGTGTACATAATGAGGCTATTAAAGGGACAGAAAACCATT
 
. : . : . : . : . : . :
rJMFF013O19+ GCAGTAGAAAGTAGTTTGGGGAAGGATGCTAAAAATAGCAAATTTCTTGTTCCTGCTTCT
rJMFF009O18+ GCAGTAGAAAGTAGTTTGGGGAAGGATGCTAAAAATAGCAAATTTCTTGTTCCTGCTTCT
rJMFF050F23+ GCAGTAGAAAGTAGTTTGGGGAAGGATGCTAAAAATAGCAAATTTCTTGTTCCTGCTTCT
                      ____________________________________________________________
consensus GCAGTAGAAAGTAGTTTGGGGAAGGATGCTAAAAATAGCAAATTTCTTGTTCCTGCTTCT
 
. : . : . : . : . : . :
rJMFF013O19+ TTTATTGGTATTCTTGTGG-TTGAACAGCTTTGTATA-TTGGAACGGAACA
rJMFF009O18+ TTTATTGGTATTCTTGTGGTTTGAACAGCTTTGTATATTTGGAACGGAACAATAACCAAC
rJMFF050F23+ TTTATTGGTATTCTTGTGGTTTGAACAGCTTTGTATATTTGGAACGGAACAATAACCAAC
                      ____________________________________________________________
consensus TTTATTGGTATTCTTGTGGTTTGAACAGCTTTGTATATTTGGAACGGAACAATAACCAAC
 
. : . : . : . : . : . :
rJMFF009O18+ CGGGTTGAAAAGAACAAACTGCATCTTTTACCTGTCTCATCAATTATAAAGAGACT
rJMFF050F23+ CGGGTTGAAAAGAACAAACTGCATCTTTTACCTGTCTCATCAATTATAAAGAGACTTAGA
                      ____________________________________________________________
consensus CGGGTTGAAAAGAACAAACTGCATCTTTTACCTGTCTCATCAATTATAAAGAGACTTAGA
 
. : . : . : . : . : . :
rJMFF050F23+ CTTAANCTXXXXXXXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus CTTAANCTNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAGG