Previous Contig 010982:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001A24Sequence550005698 (7)gb:AP003407_18289168e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107804010982 (9)gb:AY128283_15805852e-99Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF003M18Sequence591005698 (7)gb:AY128283_15805853e-34Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086 703010982 (9)gb:AY128283_15805853e-79Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF010P03Sequence552000571 (4)gb:AP003407_18289167e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107710010982 (9)gb:AY128283_15805853e-79Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF017I14Sequence566000571 (4)gb:AY128283_15805853e-25Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086 779010982 (9)gb:AP003407_18289161e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107
JMFF025O16Sequence548005698 (7)gb:AP003407_18289163e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107781010982 (9)gb:AY128283_15805855e-94Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF032P15Sequence553000571 (4)gb:AY128283_15805851e-26Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086 778010982 (9)gb:AY128283_15805852e-94Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF039L04Sequence564000571 (4)gb:AP003407_18289169e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B107780010982 (9)gb:AY128283_15805855e-94Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF045L13Sequence679005698 (7)gb:AY128283_15805859e-54Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086 409010982 (9)gb:AY128283_15805853e-34Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086
JMFF050E16Sequence573005698 (7)gb:AY128283_15805852e-32Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086 638010982 (9)gb:AY128283_15805858e-60Arabidopsis thaliana At1g65600/F5I14_13 mRNA, complete cds.>gb:BT000831_1635086

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039L04+ TCAGTAAGATCTTCAAATACAAATTTGTTCATCTCGGGGGAGATGAAGTGAATACAACT
rJMFF032P15+ TCAGTAAGATCTTCAAATACAAATTTGTTCATCTCGGGGGAGATGAAGTGAATACAACT
rJMFF017I14+ CAGTAAGATCTTCAAATACAAATTTGTTCATCTCGGGGGAGATGAAGTGAATACAACT
rJMFF025O16+ TTCAGTAAGATCTTCAAATACAAATTTGTTCATCTCGGGGGAGATGAAGTGAATACAACT
                      ____________________________________________________________
consensus TTCAGTAAGATCTTCAAATACAAATTTGTTCATCTCGGGGGAGATGAAGTGAATACAACT
 
. : . : . : . : . : . :
rJMFF039L04+ TGCTGGACATCGACTCNTCGTATAGAGAAGTGGTTAAAGACACGCCATTTCGATGGACAA
rJMFF032P15+ TGCTGGACATCGACTCCTCGTATAGAGAAGTGGTTAAAGACACGCCATTTCGATGGACAA
rJMFF017I14+ TGCTGGACATCGACTCCTCGTATAGAGAAGTGGCTAAAGACACGCCATTTCGATGGACAA
rJMFF003M18+ TCGTATAGAGAAGTGGTTAAAGACACGCCATTTCGATGGACAA
rJMFF025O16+ TGCTGGACATCGACTCNTCGTATAGAGAAGTGGTTAAAGACACGCCATTTCGATGGACAA
rJMFF010P03+ TCGTATAGAGAAGTGGTTAAAGACACGCCATTTCGATGGACAA
                      ____________________________________________________________
consensus TGCTGGACATCGACTCCTCGTATAGAGAAGTGGTTAAAGACACGCCATTTCGATGGACAA
 
. : . : . : . : . : . :
rJMFF039L04+ CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
rJMFF032P15+ CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
rJMFF017I14+ CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
rJMFF003M18+ CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
rJMFF025O16+ CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
rJMFF010P03+ CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
                      ____________________________________________________________
consensus CAGGCATACCAATATTTTGTCTTGCAAGCACAGAAGATAGCTCTATCTCATGGATATGAA
 
. : . : . : . : . : . :
rJMFF039L04+ ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
rJMFF032P15+ ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
rJMFF017I14+ ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTCTT
rJMFF001A24+ GGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
rJMFF003M18+ ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
rJMFF025O16+ ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
rJMFF010P03+ ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
rJMFF050E16+ CTTCAACAATTTTGGCAACAAGTGNAGTCGCAAAACTGTT
                      ____________________________________________________________
consensus ATTATAAACTGGGAAGAGACCTTCAACAATTTTGGCAACAAGTTGAGTCGCAAAACTGTT
 
. : . : . : . : . : . :
rJMFF039L04+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF032P15+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF017I14+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF001A24+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF003M18+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF025O16+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF010P03+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
rJMFF050E16+ GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
                      ____________________________________________________________
consensus GTCCATAACTGGCTCGGGGGTGGTCTGGCTCAGCAAGTGGTTGCAGCTGGACTGCGGTGC
 
. : . : . : . : . : . :
rJMFF039L04+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF032P15+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF017I14+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF001A24+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF003M18+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF025O16+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF010P03+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
rJMFF050E16+ ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
                      ____________________________________________________________
consensus ATTGTGAGCAACCAGGACAGATGGTATTTGGATCACTTAGATGCTCCGTGGGATGGTTTT
 
. : . : . : . : . : . :
rJMFF039L04+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF032P15+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF017I14+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF001A24+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF003M18+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF025O16+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF010P03+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
rJMFF045L13+ CAGACCCAAAGCACCAGGCGCTGGTTTTTGGC
rJMFF050E16+ TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
                      ____________________________________________________________
consensus TACTCGAACGAGCCACTGGATAACATCACAGACCCAAAGCACCAGGCGCTGGTTCTTGGC
 
. : . : . : . : . : . :
rJMFF039L04+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF032P15+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF017I14+ GGGGAAGTATGCATGTGGGGAGAGAACATCGGATGCTTCAGATATCGAGCAAACCATATG
rJMFF001A24+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF003M18+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF025O16+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF010P03+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF045L13+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
rJMFF050E16+ GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
                      ____________________________________________________________
consensus GGGGAAGTATGCATGTGGGGAGAGAACAT-TGATGCTTCAGATATCGAGCAAACCATATG
 
. : . : . : . : . : . :
rJMFF039L04+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF032P15+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF017I14+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF001A24+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF003M18+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF025O16+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF010P03+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
rJMFF045L13+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTTGTTTGAGAACCTCCCGGATGA
rJMFF050E16+ GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
                      ____________________________________________________________
consensus GCCCCGTGCTGCAGCTGCTGCAGAGAGGCTGTGGACTTCGTCTGAGAACCTCCCGGATGA
 
. : . : . : . : . : . :
rJMFF039L04+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF032P15+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF017I14+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF001A24+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF003M18+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF025O16+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF010P03+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF045L13+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
rJMFF050E16+ TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
                      ____________________________________________________________
consensus TCCAAATAAAGTTGCGGGAAGGCTGGCACACTTCAGGTGTTTGTTGAACCAACGAGGTGT
 
. : . : . : . : . : . :
rJMFF039L04+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF032P15+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF017I14+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF001A24+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF003M18+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF025O16+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF010P03+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF045L13+ GGCTGCAGCGCCACTGGTCGGATTTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
rJMFF050E16+ GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
                      ____________________________________________________________
consensus GGCTGCAGCGCCACTGGTCGGATCTGGGCGAGGTGCCCCGGAACAGCCAGGATCTTGCCA
 
. : . : . : . : . : . :
rJMFF039L04+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF032P15+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF017I14+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF001A24+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF003M18+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF025O16+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF010P03+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF045L13+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
rJMFF050E16+ TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
                      ____________________________________________________________
consensus TTTGCAGTAGTGGTAGTTAGGTCTGTCATTTTTAATTTTTGTCTGTTGGTTCCAACACTC
 
. : . : . : . : . : . :
rJMFF039L04+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
rJMFF032P15+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
rJMFF017I14+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
rJMFF001A24+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAACTTGTCCATAATCAATG
rJMFF003M18+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
rJMFF025O16+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
rJMFF010P03+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
rJMFF045L13+ TAACTGAATAAACGACCTTGCCCCACATATGTACTAGGGAAC-TGTCCATAATCAATTGA
rJMFF050E16+ TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAATTGA
                      ____________________________________________________________
consensus TAACTGAATAAACGACCTTGCACCACATATGTACTAGGGAAC-TGTCCATAATCAA-TGA
 
. : . : . : . : . : . :
rJMFF039L04+ AAT
rJMFF032P15+ AA
rJMFF017I14+ AAT
rJMFF003M18+ AAT
rJMFF025O16+ AAT
rJMFF010P03+ AAT
rJMFF045L13+ AATTTGAAAAGCCCTTGGG
rJMFF050E16+ AATTTGAAAAGCACTTGGGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AATTTGAAAAGCCCTTGGGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG