Previous Contig 010975:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033I21Sequence533001504 (2)gb:AY039613_15603261e-24Arabidopsis thaliana AT3g61710/F15G16_100 mRNA, complete cds.>gb:BT000508_163478761010975 (2)gb:AY039613_15603264e-83Arabidopsis thaliana AT3g61710/F15G16_100 mRNA, complete cds.>gb:BT000508_163478
JMFF050D21Sequence638001504 (2)gb:AY039613_15603264e-38Arabidopsis thaliana AT3g61710/F15G16_100 mRNA, complete cds.>gb:BT000508_163478601010975 (2)gb:AY039613_15603264e-60Arabidopsis thaliana AT3g61710/F15G16_100 mRNA, complete cds.>gb:BT000508_163478

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033I21+ GTACTTAATGATGCCTTCCCCAATTGGACACGATGGTGAATTT
                      ____________________________________________________________
consensus GTACTTAATGATGCCTTCCCCAATTGGACACGATGGTGAATTT
 
. : . : . : . : . : . :
rJMFF033I21+ GGAACAATTAATAACTTTCGCTTGGGAAGACTTCCTAAAATTCCAGTTGAATGGGATGAG
                      ____________________________________________________________
consensus GGAACAATTAATAACTTTCGCTTGGGAAGACTTCCTAAAATTCCAGTTGAATGGGATGAG
 
. : . : . : . : . : . :
rJMFF033I21+ ATAAATGCTGCATGGGGCCAAGCTTGCTTACTTCTCCATACGATGGCTCAATATTTTCGA
rJMFF050D21+ GA
                      ____________________________________________________________
consensus ATAAATGCTGCATGGGGCCAAGCTTGCTTACTTCTCCATACGATGGCTCAATATTTTCGA
 
. : . : . : . : . : . :
rJMFF033I21+ CCAAAGTTTCCATACCAGATAAAGATTCTTCCCATGGGAAGTTACCCTCGAATCATGGAC
rJMFF050D21+ CCAAAGTTTCCATACCAGATAAAGATTCTTCCCATGGGAAGTTACCCTCGAATCATGGAC
                      ____________________________________________________________
consensus CCAAAGTTTCCATACCAGATAAAGATTCTTCCCATGGGAAGTTACCCTCGAATCATGGAC
 
. : . : . : . : . : . :
rJMFF033I21+ ACCAACAACCATACTTTATGAGCTCTTTGGTCCAGTAAACCTTTTCTGGAGCACACGCTA
rJMFF050D21+ ACCAACAACCATAC-TTATGAGCTCTTGGTCCCAGTAAACCTTTTCTGGAGCACACGCTA
                      ____________________________________________________________
consensus ACCAACAACCATACTTTATGAGCTCTTTGTTCCAGTAAACCTTTTCTGGAGCACACGCTA
 
. : . : . : . : . : . :
rJMFF033I21+ TGACAAAGCAATGACCTTGTTTTTGAATTGCCTCAAGGAGTTTGCTGAGTTTGCCAATGC
rJMFF050D21+ TGACAAAGCAATGACCTTGTTTTTGAATTGCCTCAAGGAGTTTGCTGAGTTTGCCAATGC
                      ____________________________________________________________
consensus TGACAAAGCAATGACCTTGTTTTTGAATTGCCTCAAGGAGTTTGCTGAGTTTGCCAATGC
 
. : . : . : . : . : . :
rJMFF033I21+ TAAAGATAGAGAGAATAATATTCCTCCTGAGAAACGTTTTAGGCTTCCCTACAAGATCGA
rJMFF050D21+ TAAAGATAGAGAGAATAATATTCCTCCTGAGAAACGTTTTAGGCTTCCCTACAAGATCGA
                      ____________________________________________________________
consensus TAAAGATAGAGAGAATAATATTCCTCCTGAGAAACGTTTTAGGCTTCCCTACAAGATCGA
 
. : . : . : . : . : . :
rJMFF033I21+ AAACGACAAAGTAGAAAATTGCTCCATCACTCAAAGCTTTAACAAACAGGAGAATTGGAC
rJMFF050D21+ AAACGACAAAGTAGAAAATTGCTCCATCACTCAAAGCTTTAACAAACAGGAGAATTGGAC
                      ____________________________________________________________
consensus AAACGACAAAGTAGAAAATTGCTCCATCACTCAAAGCTTTAACAAACAGGAGAATTGGAC
 
. : . : . : . : . : . :
rJMFF033I21+ CAAAGCTCTCAAGTACACCCTCTGTAACTTGAAATGGGTGCTATACTGGTTTGTAGGGAA
rJMFF050D21+ CAAAGCTCTCAAGTACACCCTCTGTAACTTGAAATGGGTGCTATACTGGTTTGTAGGGAA
                      ____________________________________________________________
consensus CAAAGCTCTCAAGTACACCCTCTGTAACTTGAAATGGGTGCTATACTGGTTTGTAGGGAA
 
. : . : . : . : . : . :
rJMFF033I21+ CACAAATTTCCAACCTCTTTCAGCCCCCGTCTCATCTCAATCGGAAGTTCCAGCTGCTGC
rJMFF050D21+ CACAAATTTCCAACCTCTTTCAGCCCCCGTCTCATCTCAATCGGAAGTTCCAGCTGCTGC
                      ____________________________________________________________
consensus CACAAATTTCCAACCTCTTTCAGCCCCCGTCTCATCTCAATCGGAAGTTCCAGCTGCTGC
 
. : . : . : . : . : . :
rJMFF033I21+ AACTTCGATGTACAACAAAAAACCCACTGATGCCAAATAATACGATTCTATCTATAACTA
rJMFF050D21+ AACTTCGATGTACAACAAAAAACCCACTGATGCCAAATAATACGATTCTATCTATAACTA
                      ____________________________________________________________
consensus AACTTCGATGTACAACAAAAAACCCACTGATGCCAAATAATACGATTCTATCTATAACTA
 
. : . : . : . : . : . :
rJMFF033I21+ ACCATATTGTATTTAGATAAATACAGCAACAGGAAGGCCATCCTGTCCAGTTCAAAATTT
rJMFF050D21+ ACCATATTGTATTTAGATAAATACAGCAACAGGAAGGCCATCCTGTCCAGTTCAAAATTT
                      ____________________________________________________________
consensus ACCATATTGTATTTAGATAAATACAGCAACAGGAAGGCCATCCTGTCCAGTTCAAAATTT
 
. : . : . : . : . : . :
rJMFF033I21+ GTAATTATATACTTCACAATCTACCCATCATGGGCTTCTTTAACTAGGGGACT
rJMFF050D21+ GTAATTATATACTTCACAATCTACCCATCATGGGCTTCTTTAACTAGGGGACTTGAAAAT
                      ____________________________________________________________
consensus GTAATTATATACTTCACAATCTACCCATCATGGGCTTCTTTAACTAGGGGACTTGAAAAT