Previous Contig 010973:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050D16Sequence645007035 (4)gb:AB008269_15104804e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSL3.>gb:AY062108_15649596010973 (2)
JMSF035K24Sequence672007035 (4)gb:AB008269_15104805e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSL3.>gb:AY062108_15649605010973 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035K24+ TTGTGGAATTTGAGTCTATGAGTGCTATGCAAAATGCAATAGAGGCCTCGCCAATA
                      ____________________________________________________________
consensus TTGTGGAATTTGAGTCTATGAGTGCTATGCAAAATGCAATAGAGGCCTCGCCAATA
 
. : . : . : . : . : . :
rJMSF035K24+ ACAATAGAGGGTCGCCAAGCTGTAGTCGAGGAAAAGAGAACCACCACTAGAGTTGTGGGC
rJMFF050D16+ TAGAGGGTCGCCAAGCTGTAGTCGAGGAAAAGAGAACCACCACTAGAGTTGTGGGC
                      ____________________________________________________________
consensus ACAATAGAGGGTCGCCAAGCTGTAGTCGAGGAAAAGAGAACCACCACTAGAGTTGTGGGC
 
. : . : . : . : . : . :
rJMSF035K24+ AGCTCAAGAGGAGGGGGGAGGTACTCTTCTGGAAGAGGCGGGTTCCGGGGTGAAAGTTTC
rJMFF050D16+ AGCTCAAGAGGAGGGGGGAGGTACTCTTCTGGAAGAGGCGGGTTCCGGGGTGAAAGTTTC
                      ____________________________________________________________
consensus AGCTCAAGAGGAGGGGGGAGGTACTCTTCTGGAAGAGGCGGGTTCCGGGGTGAAAGTTTC
 
. : . : . : . : . : . :
rJMSF035K24+ AGAGGCCGTGGAAACTTTGGTGGCGGGAGAGGCTATGGCAGGAGCGAGTTCAGGAACCAG
rJMFF050D16+ AGAGGCCGTGGAAACTTTGGTGGCGGGAGAGGCTATGGCAGGAGCGAGTTCAGGAACCAG
                      ____________________________________________________________
consensus AGAGGCCGTGGAAACTTTGGTGGCGGGAGAGGCTATGGCAGGAGCGAGTTCAGGAACCAG
 
. : . : . : . : . : . :
rJMSF035K24+ GCTGATTTCGGTATTCGGTCAAAGGGGCGTAACGTTGAGACCTATAGGCGTGTAGACCAG
rJMFF050D16+ GCTGATTTCGGTATTCGGTCAAAGGGGCGTAACGTTGAGACCTATAGGCGTGTAGACCAG
                      ____________________________________________________________
consensus GCTGATTTCGGTATTCGGTCAAAGGGGCGTAACGTTGAGACCTATAGGCGTGTAGACCAG
 
. : . : . : . : . : . :
rJMSF035K24+ AACGAGAGCACTCGTCAAGGAGGGATGAATAAGAACACAACTTCTGCGTAGTCGAAGCAA
rJMFF050D16+ AACGAGAGCACTCGTCAAGGAGGGATGAATAAGAACACAACTTCTGCGTAGTCGAAGCAA
                      ____________________________________________________________
consensus AACGAGAGCACTCGTCAAGGAGGGATGAATAAGAACACAACTTCTGCGTAGTCGAAGCAA
 
. : . : . : . : . : . :
rJMSF035K24+ TAATAAATTTTGCACACTTGATTAAGTTTTCCAAAAGTTCTGATTTAGTTGCTTTCATTA
rJMFF050D16+ TAATAAATTTTGCACACTTGATTAAGTTTTCCAAAAGTTCTGATTTAGTTGCTTTCATTA
                      ____________________________________________________________
consensus TAATAAATTTTGCACACTTGATTAAGTTTTCCAAAAGTTCTGATTTAGTTGCTTTCATTA
 
. : . : . : . : . : . :
rJMSF035K24+ ACCTCCCTCTTGTGACAATTGCCCCCAACCCCCCATGCTTTTTTATTTTTTTTCTTTGTT
rJMFF050D16+ ACCTCCCTCTTGTGACAATTGCCCCCAACCCCCCATGCTTTTTTATTTTTTTTCTTTGTT
                      ____________________________________________________________
consensus ACCTCCCTCTTGTGACAATTGCCCCCAACCCCCCATGCTTTTTTATTTTTTTTCTTTGTT
 
. : . : . : . : . : . :
rJMSF035K24+ GAGTGATCCAGAGATCATTAGATGTTGAGGTTTACATGAGAGTCATATGNGAGNGTTTCT
rJMFF050D16+ GAGTGATCCAGAGATCATTAGATGTTGAGGTTTACATGAGAGTCATATGTGAGTGTTTCT
                      ____________________________________________________________
consensus GAGTGATCCAGAGATCATTAGATGTTGAGGTTTACATGAGAGTCATATGTGAGTGTTTCT
 
. : . : . : . : . : . :
rJMSF035K24+ ATTATTAGTAATATTTTTTTTGCTTCCATTTTAAGCTTAGGCTAGATACACGTTTGATAG
rJMFF050D16+ ATTATTAGTAATATTTTTTTTGCTTCCATTTTAAGCTTAGGCTAGATACACGTTTGATAG
                      ____________________________________________________________
consensus ATTATTAGTAATATTTTTTTTGCTTCCATTTTAAGCTTAGGCTAGATACACGTTTGATAG
 
. : . : . : . : . : . :
rJMSF035K24+ GAATTGTAT
rJMFF050D16+ GAATTGTATTTTTTTTAAAAGAAAATAATCTCTCTTTAATACAATTTTGTGTTCTATGAT
                      ____________________________________________________________
consensus GAATTGTATTTTTTTTAAAAGAAAATAATCTCTCTTTAATACAATTTTGTGTTCTATGAT