Previous Contig 010965:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050C08Sequence607005860 (4)gb:AY039960_15604681e-16Arabidopsis thaliana unknown protein (At1g70100) mRNA, complete cds.>gb:AY079401582010965 (4)
JMSF019P17Sequence268005860 (4)768010965 (4)gb:AY039960_15604683e-04Arabidopsis thaliana unknown protein (At1g70100) mRNA, complete cds.>gb:AY079401
JMSF033K11Sequence586005860 (4)gb:AY039960_15604681e-15Arabidopsis thaliana unknown protein (At1g70100) mRNA, complete cds.>gb:AY079401736010965 (4)gb:AY039960_15604683e-04Arabidopsis thaliana unknown protein (At1g70100) mRNA, complete cds.>gb:AY079401
JMSF052K11Sequence899010965 (4)gb:AY039960_15604684e-04Arabidopsis thaliana unknown protein (At1g70100) mRNA, complete cds.>gb:AY079401

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052K11+ GGATTCAGAACGGGGGGTCATCGTTGC
                      ____________________________________________________________
consensus GGATTCAGAACGGGGGGTCATCGTTGC
 
. : . : . : . : . : . :
rJMSF052K11+ ATAGGAGCAAGAATAATTCTCCCGTTATCACAGATAACAAGCGGGTAGCACGAACTTCTT
                      ____________________________________________________________
consensus ATAGGAGCAAGAATAATTCTCCCGTTATCACAGATAACAAGCGGGTAGCACGAACTTCTT
 
. : . : . : . : . : . :
rJMSF019P17+ TCAAAACNTGATGCGAA
rJMSF052K11+ TGCACATGTCCCTCAGTTTGAGTCCCGCAAATTCTGCTGCATCTCAAAACATGATGCGAA
                      ____________________________________________________________
consensus TGCACATGTCCCTCAGTTTGAGTCCCGCAAATTCTGCTGCATCTCAAAACATGATGCGAA
 
. : . : . : . : . : . :
rJMSF033K11+ GACCAGCAAAACCCGTGGAATCTCGTATTGCAATGGGAA
rJMSF019P17+ GATCTGTGATTACGGAGACTGGACCAGCAAAACCCGTGGAATCTCGTATTGCAATGGGAA
rJMSF052K11+ GATCTGTGATTACGGAGACTGGACCAGCAAAACCCGTGGAATCTCGTATTGCAATGGGAA
                      ____________________________________________________________
consensus GATCTGTGATTACGGAGACTGGACCAGCAAAACCCGTGGAATCTCGTATTGCAATGGGAA
 
. : . : . : . : . : . :
rJMSF033K11+ GGTCTTTGATTATGGATAGAATGGGGGACAAGGAGATTGTAAAGCGGGCATTCAAGACTT
rJMSF019P17+ GGTCTTTGATTATGGATAGAATGGGGGACAAGGAGATTGTAAAGCGGGCATTCAAGACTT
rJMSF052K11+ GGTCTTTGATTATGGATAGAATGGGGGACAAGGAGATTGTAAAGCGGGCATTCAAGACTT
                      ____________________________________________________________
consensus GGTCTTTGATTATGGATAGAATGGGGGACAAGGAGATTGTAAAGCGGGCATTCAAGACTT
 
. : . : . : . : . : . :
rJMSF033K11+ TTAGAAACAGTTTCAATGAAATGAAATCTTCGGGTGATAAAAGCTATAGTGGATCAGGAC
rJMSF019P17+ TTAGAAACAGTTTCAATGAAATGAAATCTTCGGGTGATAAAAGCTATAGTGGATCAGGAC
rJMSF052K11+ TTAGAAACAGTTTCAATGAAATGAAATCTTCGGGTGATAAAAGCTATAGTGGATCAGGAC
                      ____________________________________________________________
consensus TTAGAAACAGTTTCAATGAAATGAAATCTTCGGGTGATAAAAGCTATAGTGGATCAGGAC
 
. : . : . : . : . : . :
rJMSF033K11+ AGATGACATCTAAAGGACCCGAGCAGAAGATTTCCACTTCTCTAACTCATAGTGGAGAGA
rJMSF019P17+ AGATGACATCTAAAGGACCCGAGCAGAAGATTTCCACTTCTCTAACTCATAGTGGAGAGA
rJMSF052K11+ AGATGACATCTAAAGGACCCGAGCAGAAGATTTCCACTTCTCTAACTCATAGTGGAGAGA
rJMFF050C08+ CCGAGCAGAAGATTTCCACTTCTCTAACTCATAGTGGAGAGA
                      ____________________________________________________________
consensus AGATGACATCTAAAGGACCCGAGCAGAAGATTTCCACTTCTCTAACTCATAGTGGAGAGA
 
. : . : . : . : . : . :
rJMSF033K11+ ACGGAAGATTGGGGAAGCCAAATCAAAGAGTAACTACTCAAAAAGGCCAATCGGGGACAA
rJMSF019P17+ ACGGAAGATTGGGGAAGCCAAATCAAAGAGTAACTACTCAAAAAGGCCAATCGGGGACAA
rJMSF052K11+ ACGGAAGATTGGGGAAGCCAAATCAAAGAGTAACTACTCAAAAAGGCCAATCGGGGACAA
rJMFF050C08+ ACGGAAGATTGGGGAAGCCAAATCAAAGAGTAACTACTCAAAAAGGCCAATCGGGGACAA
                      ____________________________________________________________
consensus ACGGAAGATTGGGGAAGCCAAATCAAAGAGTAACTACTCAAAAAGGCCAATCGGGGACAA
 
. : . : . : . : . : . :
rJMSF033K11+ AATCAAGTTCTGTTTCATCAAGGAGGGTGCCAAACCTAAGATCCAACGTCCCGTGAAATA
rJMSF019P17+ AATCAAGTTCTGTTTCATCAAGGAGGGTGCCAAACCTAAGATCCAACGTCCCGTGAAATA
rJMSF052K11+ AATCAAGTTCTGTTTCATCAAGGAGGGTGCCAAACCTAAGATCCAACGTCCCGTGAAATA
rJMFF050C08+ AATCAAGTTCTGTTTCATCAAGGAGGGTGCCAAACCTAAGATCCAACGTCCCGTGAAATA
                      ____________________________________________________________
consensus AATCAAGTTCTGTTTCATCAAGGAGGGTGCCAAACCTAAGATCCAACGTCCCGTGAAATA
 
. : . : . : . : . : . :
rJMSF033K11+ GGTGGAAAGAGCGTACGAAACCAATGTACAATATTGCGAGTAGAGCAAGAGAGCTTGGAT
rJMSF019P17+ GGTGGAAAGAGCGTACGAAACCAATGTACAATATTGCGAGTAGAGCAAGAGAGCTTGGAT
rJMSF052K11+ GGTGGAAAGAGCGTACGAAACCAATGTACAATATTGCGAGTAGAGCAAGAGAGCTTGGAT
rJMFF050C08+ GGTGGAAAGAGCGTACGAAACCAATGTACAATATTGCGAGTAGAGCAAGAGAGCTTGGAT
                      ____________________________________________________________
consensus GGTGGAAAGAGCGTACGAAACCAATGTACAATATTGCGAGTAGAGCAAGAGAGCTTGGAT
 
. : . : . : . : . : . :
rJMSF033K11+ CTTCAGCACACGGTATACTTATGGCATATATGCACCTCGGGTAACACCATTTGATAATAT
rJMSF019P17+ CTTCAGCACACGGTATACTTATGGCATATATGCACCTCGGGTAACACCATTTGATAATAT
rJMSF052K11+ CTTCAGCACACGGTATACTTATGGCATATATGCACCTCGGGTAACACCATTTGATAATAT
rJMFF050C08+ CTTCAGCACACGGTATACTTATGGCATATATGCACCTCGGGTAACACCATTTGATAATAT
                      ____________________________________________________________
consensus CTTCAGCACACGGTATACTTATGGCATATATGCACCTCGGGTAACACCATTTGATAATAT
 
. : . : . : . : . : . :
rJMSF033K11+ AGCAAAAGAAGTCAGCATAATGTTTTCCAAACTGTAATGCCACCTTCGATCACGCTATGT
rJMSF019P17+ AGCAAAAGAAGTCAGCATAATGTTTTCCAAACTGTAATGCCACCTTCGATCACGCTATGT
rJMSF052K11+ AGCAAAAGAAGTCAGCATAATGTTTTCCAAACTGTAATGCCACCTTCGATCACGCTATGT
rJMFF050C08+ AGCAAAAGAAGTCAGCATAATGTTTTCCAAACTGTAATGCCACCTTCGATCACGCTATGT
                      ____________________________________________________________
consensus AGCAAAAGAAGTCAGCATAATGTTTTCCAAACTGTAATGCCACCTTCGATCACGCTATGT
 
. : . : . : . : . : . :
rJMSF033K11+ CGCCCCTATCCTTTTGTGTGTAAAAATGCGTTTGTATGAATTATTGTGTGTCGTCTTTCC
rJMSF019P17+ CGCCCCTATCCTTTTGTGTGTAAAAATGCGTTTGTATGAATTATTGTGTGTCGTCTTTCC
rJMSF052K11+ CGCCCCTATCCTTTTGTGTGTAAAAATGCGTTTGTATGAATTATTGTGTGTCGTCTTTCC
rJMFF050C08+ CGCCCCTATCCTTTTGTGTGTAAAAATGCGTTTGTATGAATTATTGTGTGTCGTCTTTCC
                      ____________________________________________________________
consensus CGCCCCTATCCTTTTGTGTGTAAAAATGCGTTTGTATGAATTATTGTGTGTCGTCTTTCC
 
. : . : . : . : . : . :
rJMSF033K11+ CCCCGCTCTTGCATAGTGTTTGATATATAGTAGGGAATTAGGGATGGAAAACTGCTGGAG
rJMSF019P17+ CCCCGCTCTTGCATAGTGTTTGATATATAGTAGGGAATTAGGGATGGAAAACTGCTGGAG
rJMSF052K11+ CCCCGCTCTTGCATAGTGTTTGATATATAGTAGGGAATTAGGGATGGAAAACTGCTGGAG
rJMFF050C08+ CCCCGCTCTTGCATAGTGTTTGATATATAGTAGGGAATTAGGGATGGAAAACTGCTGGAG
                      ____________________________________________________________
consensus CCCCGCTCTTGCATAGTGTTTGATATATAGTAGGGAATTAGGGATGGAAAACTGCTGGAG
 
. : . : . : . : . : . :
rJMSF033K11+ AAATTCCGAGTTTCACTTAGTGAGTAGAGATGCAATGGGTTGTAAAACCAGAGCTCATGG
rJMSF019P17+ AAATTCCGAGTTTCACTTAGTGAGTAGAGATGCAATGGGTTGTAAAACCAGAGCTCATGG
rJMSF052K11+ AAATTCCGAGTTTCACTTAGTGAGTAGAGATGCAATGGGTTGTAAAACCAGAGCTCATGG
rJMFF050C08+ AAATTCCGAGTTTCACTTAGTGAGTAGAGATGCAATGGGTTGTAAAACCAGAGCTCATGG
                      ____________________________________________________________
consensus AAATTCCGAGTTTCACTTAGTGAGTAGAGATGCAATGGGTTGTAAAACCAGAGCTCATGG
 
. : . : . : . : . : . :
rJMSF033K11+ ATTAAAGTTATTGTAAGTCATTGTTAGATTT
rJMSF019P17+ ATTAAAGTTATTGTAAGTCATTGTTAGATTT
rJMSF052K11+ ATTAAAGTTATTGTAAGTCATTGTTAGATTT
rJMFF050C08+ ATTAAAGTTATTGTAAGTCATTGTTAGATTTTGTAATTGATTCAATGCAAGAGCATGAAT
                      ____________________________________________________________
consensus ATTAAAGTTATTGTAAGTCATTGTTAGATTTTGTAATTGATTCAATGCAAGAGCATGAAT