Previous Contig 010963:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004J04Sequence563000208 (7)gb:BT015383_16422118e-47Arabidopsis thaliana At3g52490 gene, complete cds.672010963 (3)gb:BT015383_16422110.002Arabidopsis thaliana At3g52490 gene, complete cds.
JMFF038P20Sequence563000208 (7)gb:BT015383_16422118e-47Arabidopsis thaliana At3g52490 gene, complete cds.657010963 (3)gb:BT015383_16422117e-11Arabidopsis thaliana At3g52490 gene, complete cds.
JMFF050C04Sequence607000208 (7)gb:BT015383_16422116e-54Arabidopsis thaliana At3g52490 gene, complete cds.593010963 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038P20+ CCGAGGAAGAAGTGGTGAGCAAGAAAAGGGCGAGAGATGAGCAAG
                      ____________________________________________________________
consensus CCGAGGAAGAAGTGGTGAGCAAGAAAAGGGCGAGAGATGAGCAAG
 
. : . : . : . : . : . :
rJMFF038P20+ GAAGAAGCTATCTTGAGNGGTTCATGGACGCGGTTCGAGAAAACCCTAGCCGGGTTTTCT
rJMFF004J04+ T
                      ____________________________________________________________
consensus GAAGAAGCTATCTTGAGNGGTTCATGGACGCGGTTCGAGAAAACCCTAGCCGGGTTTTCT
 
. : . : . : . : . : . :
rJMFF038P20+ TCATGGAGGATNTTGATCAAGCCGATTACCATTCCCAAAAGGGAATCAAGAAACTCATTG
rJMFF004J04+ TCATGGAGGATNTTGATCAAGCCGATTACCATTCCCAAAAGGGAATCAAGAAACTCATTG
                      ____________________________________________________________
consensus TCATGGAGGATNTTGATCAAGCCGATTACCATTCCCAAAAGGGAATCAAGAAACTCATTG
 
. : . : . : . : . : . :
rJMFF038P20+ AAAGCGGGAGCTTTACGCCGCCGCACGACGGCGGCGGCGAGGTGGTGGGAATGAAGGACG
rJMFF004J04+ AAAGCGGGAGCTTTACGCCGCCGCACGACGGCGGCGGCGAGGTGGTGGGAATGAAGGACG
                      ____________________________________________________________
consensus AAAGCGGGAGCTTTACGCCGCCGCACGACGGCGGCGGCGAGGTGGTGGGAATGAAGGACG
 
. : . : . : . : . : . :
rJMFF038P20+ CCATTGTCATTTTCAGCTGNGAAAGCTCCGGCTCGAGAGCCCCCTNTCCTCCTCCTTCCC
rJMFF004J04+ CCATTGTCATTTTCAGCTGNGAAAGCTCCGGCTCGAGAGCCCCCTTTCCTCCTCCTTCCC
rJMFF050C04+ CATTTTCAGCTGCGAAAGCTCCGGCTCGAGAGCCCCCTCTCCTCCTCCTTCCC
                      ____________________________________________________________
consensus CCATTGTCATTTTCAGCTGCGAAAGCTCCGGCTCGAGAGCCCCCTTTCCTCCTCCTTCCC
 
. : . : . : . : . : . :
rJMFF038P20+ CGCCAAAACACATTCAAGAAAACAAAGATCAAGAAAAGCCATGTTGGGATNTTAACGTTG
rJMFF004J04+ CGCCAAAACACATTCAAGAAAACAAAGATCAAGAAAAGCCATGTTTGGATNTTAACGTTG
rJMFF050C04+ CGCCAAAACACATTCAAGAAAACAAAGATCAAGAAAAGCCATGTTTGGATCTTAACGTTG
                      ____________________________________________________________
consensus CGCCAAAACACATTCAAGAAAACAAAGATCAAGAAAAGCCATGTTTGGATCTTAACGTTG
 
. : . : . : . : . : . :
rJMFF038P20+ CAAGTGAAGATCATAGTGACGAACGTTGTTCAACTCCGAACAATAATGCTGGGATTTTGG
rJMFF004J04+ CAAGTGAAGATCATAGTGACGAACGTTGTTCAACTCCGAACAATAATGCTGGGATTTTGG
rJMFF050C04+ CAAGTGAAGATCATAGTGACGAACGTTGTTCAACTCCGAACAATAATGCTGGGATTTTGG
                      ____________________________________________________________
consensus CAAGTGAAGATCATAGTGACGAACGTTGTTCAACTCCGAACAATAATGCTGGGATTTTGG
 
. : . : . : . : . : . :
rJMFF038P20+ AAGCTGTGGATAAACAAATCCTGTTTAAAATTCAAGTNTTGTGAGAGCACGAAATCACAA
rJMFF004J04+ AAGCTGTGGATAAACAAATCCTGTTTAAAATTCAAGTNTTGTGAGAGCACGAAATCACAA
rJMFF050C04+ AAGCTGTGGATAAACAAATCCTGTTTAAAATTCAAGTCTTGTGAGAGCACGAAATCACAA
                      ____________________________________________________________
consensus AAGCTGTGGATAAACAAATCCTGTTTAAAATTCAAGTCTTGTGAGAGCACGAAATCACAA
 
. : . : . : . : . : . :
rJMFF038P20+ ATCCTGTCGGGTCGGATGTGAAACTAGCACTCAGAAAATTATGTAGAATTTTCCTTTTTT
rJMFF004J04+ ATCCTGTCGGGTCGGATGTGAAACTAGCACTCAGAAAATTATGTAGAATTTTCCTTTTTT
rJMFF050C04+ ATCCTGTCGGGTCGGATGTGAAACTAGCACTCAGAAAATTATGTAGAATTTTCCTTTTTT
                      ____________________________________________________________
consensus ATCCTGTCGGGTCGGATGTGAAACTAGCACTCAGAAAATTATGTAGAATTTTCCTTTTTT
 
. : . : . : . : . : . :
rJMFF038P20+ TGTTTATTTTCAGTCTTTTTTTTTTCTTTGTTTGTAATTTTATGTTTAAATTTCAAAAAA
rJMFF004J04+ TGTTTATTTTCAGTCTTTTTTTTTTCTTTGTTTGTAATTTTATGTTTAAATTTCAAAAAA
rJMFF050C04+ TGTTTATTTTCAGTCTTTTTTTTTTCTTTGTTTGTAATTTTATGTTTAAATTTCAAAAAA
                      ____________________________________________________________
consensus TGTTTATTTTCAGTCTTTTTTTTTTCTTTGTTTGTAATTTTATGTTTAAATTTCAAAAAA
 
. : . : . : . : . : . :
rJMFF038P20+ AGAAATGGGGGAAAGGGGTAAAGTTAAGATTATCTGACAGGTCCCATAGATTTTAGGTGG
rJMFF004J04+ AGAAATGGGGGAAAGGGGTAAAGTTAAGATTATCTGACAGGTCCCATAGATTTTAGGTGG
rJMFF050C04+ AGAAATGGGGGAAAGGGGTAAAGTTAAGATTATCTGACAGGTCCCATAGATTTTAGGTGG
                      ____________________________________________________________
consensus AGAAATGGGGGAAAGGGGTAAAGTTAAGATTATCTGACAGGTCCCATAGATTTTAGGTGG
 
. : . : . : . : . : . :
rJMFF038P20+ AG-TGAAGTAGAA
rJMFF004J04+ AGTTGAAGTAGAATGAAATGAAATGTACATTTGACGTACACTTGTTTGTTCTTGTTGTGT
rJMFF050C04+ AGTTGAAGTAGAATGAAATGAAATGTACATTTGACGTACACTTGTTTGTTCTTGTTGTGT
                      ____________________________________________________________
consensus AGTTGAAGTAGAATGAAATGAAATGTACATTTGACGTACACTTGTTTGTTCTTGTTGTGT
 
. : . : . : . : . : . :
rJMFF004J04+ TTTACGGTCAATAATTTTAATATATTTTATGGTTTTAAGCTGTAATCTCTCTTTGCTAAT
rJMFF050C04+ TTTACGGTCAATAATTTTAATATATTTTATGGTTTTAAGCTGTAATCTCTCTTTGCTAAT
                      ____________________________________________________________
consensus TTTACGGTCAATAATTTTAATATATTTTATGGTTTTAAGCTGTAATCTCTCTTTGCTAAT
 
. : . : . : . : . : . :
rJMFF004J04+ TGCTATAAATA
rJMFF050C04+ TGCTATAAATATAATTAAGAAAGATTTTGTGAGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGCTATAAATATAATTAAGAAAGATTTTGTGAGAAAAAAAAAAAAAAAACTCTCCAGGGT