Previous Contig 010960:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028L08Sequence590010960 (6)gb:AY603965_16174665e-38Phaseolus vulgaris protein tyrosine phosphatase mRNA, complete cds.672010960 (6)gb:AY603965_16174665e-47Phaseolus vulgaris protein tyrosine phosphatase mRNA, complete cds.
JMFF050B17Sequence641010960 (6)gb:GMA6308_16803901e-41Glycine max mRNA for tyrosine phosphatase 1.565010960 (6)pir|T06536|T065365e-22protein-tyrosine-phosphatase (EC 3.1.3.48) - garden pea>gb:PSA5589_1702010 Pisum
JMSF046D04Sequence773010960 (6)gb:AY603965_16174663e-66Phaseolus vulgaris protein tyrosine phosphatase mRNA, complete cds.784010960 (6)gb:AC021665_15387294e-63Arabidopsis thaliana chromosome 1 BAC F17M19 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050B17- CCGGAAATTAATAATTTTGGTTGGAGACTTCACTTTTGGA
JMFF028L08- GGAGACTTCACTTTTGGA
JMSF046D04- GGAGACTTCACTTTTGGA
                      ____________________________________________________________
consensus CCGGAAATTAATAATTTTGGTTGGAGACTTCACTTTTGGA
 
. : . : . : . : . : . :
JMFF050B17- CTGAGCGTAAACTCAACGGCGCACCAACTACTCTTCCACTTCCACACCCAACAACACGGG
JMFF028L08- CTGAGCGTAAACTCAACGGCGCACCAACTACTCTTCCACTTCCACACCCAACAACACGGG
JMSF046D04- CTGAGCGTAAACTCAACGGCGCACCAACTACTCTTCCACTTCCACACCCAACAACACGGG
                      ____________________________________________________________
consensus CTGAGCGTAAACTCAACGGCGCACCAACTACTCTTCCACTTCCACACCCAACAACACGGG
 
. : . : . : . : . : . :
JMFF050B17- TAGCGCCATTTCAACTCGGACTCGCAGCCGGAGATCGGCGATGGCCGCGGCCGGAAAGTC
JMFF028L08- TAGCGCCATTTCAACTCGGACTCGCAGCCGGAGATCGGCGATGGCCGCGGCCGGAAAGTC
JMSF046D04- TAGCGCCATTTCAACTCGGACTCGCAGCCGGAGATCGGCGATGGCCGCGGCCGGAAAGTC
                      ____________________________________________________________
consensus TAGCGCCATTTCAACTCGGACTCGCAGCCGGAGATCGGCGATGGCCGCGGCCGGAAAGTC
 
. : . : . : . : . : . :
JMFF050B17- TCTTTCCTCCTCCGTCACCGGAACCGCTGCGTCGTCCGCTGAGGCTGCCCAGCCTTTCGA
JMFF028L08- TCTTTCCTCCTCCGTCACCGGAACCGCTGCGTCGTCCGCTGAGGCTGCCCAGCCTTTCGA
JMSF046D04- TCTTTCCTCCTCCGTCACCGGAACCGCTGCGTCGTCCGCTGAGGCTGCCCAGCCTTTCGA
                      ____________________________________________________________
consensus TCTTTCCTCCTCCGTCACCGGAACCGCTGCGTCGTCCGCTGAGGCTGCCCAGCCTTTCGA
 
. : . : . : . : . : . :
JMFF050B17- TTTCTCTTATGATTCGCAGCCGCCGAGGCTCGTTCTGTCGTCCGATCAGCTTCGGTACTG
JMFF028L08- TTTCTCTTATGATTCGCAGCCGCCGAGGCTCGTTCTGTCGTCCGATCAGCTTCGGTACTG
JMSF046D04- TTTCTCTTATGATTCGCAGCCGCCGAGGCTCGTTCTGTCGTCCGATCAGCTTCGGTACTG
                      ____________________________________________________________
consensus TTTCTCTTATGATTCGCAGCCGCCGAGGCTCGTTCTGTCGTCCGATCAGCTTCGGTACTG
 
. : . : . : . : . : . :
JMFF050B17- CTCCGAAGCACTCAAGGTACTCAAAGAGAAGAGGTTTCAAGCTCCCGAAAAAATCCGCCA
JMFF028L08- CTCCGAAGCACTCAAGGTACTCAAAGAGAAGAGGTTTCAAGCTCCCGAAAAAATCCGCCA
JMSF046D04- CTCCGAAGCACTCAAGGTACTCAAAGAGAAGAGGTTTCAAGCTCCCGAAAAAATCCGCCA
                      ____________________________________________________________
consensus CTCCGAAGCACTCAAGGTACTCAAAGAGAAGAGGTTTCAAGCTCCCGAAAAAATCCGCCA
 
. : . : . : . : . : . :
JMFF050B17- GGAGTTCGGTACCTTACAGGCAAATAGGATGAGGGCTTCAGATATGAGGAGTAGATGCTT
JMFF028L08- GGAGTTCGGTACCTTACAGGCAAATAGGATGAGGGCTTCAGATATGAGGAGTAGATGCTT
JMSF046D04- GGAGTTCGGTACCTTACAGGCAAATAGGATGAGGGCTTCAGATATGAGGAGTAGATGCTT
                      ____________________________________________________________
consensus GGAGTTCGGTACCTTACAGGCAAATAGGATGAGGGCTTCAGATATGAGGAGTAGATGCTT
 
. : . : . : . : . : . :
JMFF050B17- AGTAGCTCTGGATAGCATAAACATCAGCAAAAACCGTTATACTGATGTATTGCCATTTGA
JMFF028L08- AGTAGCTCTGGATAGCATAAACATCAGCAAAAACCGTTATACTGATGTATTGCCATTTGA
JMSF046D04- AGTAGCTCTGGATAGCATAAACATCAGCAAAAACCGTTATACTGATGTATTGCCATTTGA
                      ____________________________________________________________
consensus AGTAGCTCTGGATAGCATAAACATCAGCAAAAACCGTTATACTGATGTATTGCCATTTGA
 
. : . : . : . : . : . :
JMFF050B17- CAGTAACAGGGTTGTTTTGAACCCATGTAAAGACTACAGACAATCAGCTAGGGGATATAT
JMFF028L08- CAGTAACAGGGTTGTTTTGAACCCATGTAAAGACTACAGACAATCAGCTAGGGGATATAT
JMSF046D04- CAGTAACAGGGTTGTTTTGAACCCATGTAAAGACTACAGACAATCAGCTAGGGGATATAT
                      ____________________________________________________________
consensus CAGTAACAGGGTTGTTTTGAACCCATGTAAAGACTACAGACAATCAGCTAGGGGATATAT
 
. : . : . : . : . : . :
JMFF050B17- CAACGCAAGCTTGATCACAGTTTCTGAACATGTATCTCGCTTTATTGCGACACAAGGTCC
JMFF028L08- CAACGCAGGCTTGATCACAGTTTCTGAACATGTATCTCGCTTTATTGCGACACAAGGTCC
JMSF046D04- CAACGCAAGCTTGATCACAGTTTCTGAACATGTATCTCGCTTTATTGCGACACAAGGTCC
                      ____________________________________________________________
consensus CAACGCAAGCTTGATCACAGTTTCTGAACATGTATCTCGCTTTATTGCGACACAAGGTCC
 
. : . : . : . : . : . :
JMFF050B17- GCTGCNCAACACCTTCGAGGACTTCTGGGGAATGGTAATCCAGAATCGTTGTCCTGCAAT
JMFF028L08- GCTGCCAAACACCTTCGAGGACTTCTGGG
JMSF046D04- GCTGCCAAACACCTTCGAGGACTTCTGGGAAATGGTAATCCAGAATCGTTGTCCTGCAAT
                      ____________________________________________________________
consensus GCTGCCAAACACCTTCGAGGACTTCTGGGGAATGGTAATCCAGAATCGTTGTCCTGCAAT
 
. : . : . : . : . : . :
JMFF050B17- T
JMSF046D04- TGTAATGCTTACACGACTGGTTGACAATTACAAGACGGTGAAGTGTGGAGACTATTTTCA
                      ____________________________________________________________
consensus TGTAATGCTTACACGACTGGTTGACAATTACAAGACGGTGAAGTGTGGAGACTATTTTCA
 
. : . : . : . : . : . :
JMSF046D04- GGCGGAGGATGGCGTTAGAGAATTT-GGGAATATATGCATCACCACAAAATGGATAAAAA
rJMSF046D04+ GTTAGAGAATTTNGGGAATATATGCATCACCACCAAATGGATAAAAA
                      ____________________________________________________________
consensus GGCGGAGGATGGCGTTAGAGAATTTNGGGAATATATGCATCACCACCAAATGGATAAAAA
 
. : . : . : . : . : . :
JMSF046D04- CAACAGATACTTCCTTAATATTGCGTTGCTTG
rJMSF046D04+ CAACAGATACTTCCTTAATATTGCGTTGCTTGGAGGTTAGCTACAAAGAGTCCGAAGAAC
                      ____________________________________________________________
consensus CAACAGATACTTCCTTAATATTGCGTTGCTTGGAGGTTAGCTACAAAGAGTCCGAAGAAC
 
. : . : . : . : . : . :
rJMSF046D04+ CACCTTTGTCTGTCTTACACTTTCAATATGCTGAATGGCCTGATCATGGAGTTCCGAAGG
rJMFF028L08+ TTACACTTTCAATATGCTGAATGGCCTGATCATGGAGTTCCGAAGG
                      ____________________________________________________________
consensus CACCTTTGTCTGTCTTACACTTTCAATATGCTGAATGGCCTGATCATGGAGTTCCGAAGG
 
. : . : . : . : . : . :
rJMSF046D04+ ACACTCTTGCTACTCGTGAAATTGTGAAGCGCTTACATACCCTGCCACCTAGTCTTGGGC
rJMFF028L08+ ACACTCTTGCTACTCGTGAAATTGTGAAGCGCTTACATACCCTGCCACCTAGTCTTGGGC
                      ____________________________________________________________
consensus ACACTCTTGCTACTCGTGAAATTGTGAAGCGCTTACATACCCTGCCACCTAGTCTTGGGC
 
. : . : . : . : . : . :
rJMSF046D04+ CAATTGTGGTGCACTGCAGTGCGGGTATTGGTAGAACTGGAACCTATTGCGCAATTCACA
rJMFF028L08+ CAATTGTGGTGCACTGCAGTGCGGGTATTGGTAGAACTGGAACCTATTGCGCAATTCACA
rJMFF050B17+ ACTGGAACCTATTGCGCAATTCACA
                      ____________________________________________________________
consensus CAATTGTGGTGCACTGCAGTGCGGGTATTGGTAGAACTGGAACCTATTGCGCAATTCACA
 
. : . : . : . : . : . :
rJMSF046D04+ ACACCATCCAAAGGATCCTACTTGGAGATATGTCCGCTTTAGATCTTGTTAACACCATCA
rJMFF028L08+ ACACCATCCAAAGGATCCTACTTGGAGATATGTCCGCTTTAGATCTTGTTAACACCATCA
rJMFF050B17+ ACACCATCCAAAGGATCCTACTTGGAGATATGTCCGCTTTAGATCTTGTTAACACCATCA
                      ____________________________________________________________
consensus ACACCATCCAAAGGATCCTACTTGGAGATATGTCCGCTTTAGATCTTGTTAACACCATCA
 
. : . : . : . : . : . :
rJMSF046D04+ CCATATTTAGGTCACAGCGAATTGGGATGGTTCAAACATTGGAACAATATCTTTTCTGCT
rJMFF028L08+ CCATATTTAGGTCACAGCGAATTGGGATGGTTCAAACATTGGAACAATATCTTTTCTGCT
rJMFF050B17+ CCATATTTAGGTCACAGCGAATTGGGATGGTTCAAACATTGGAACAATATCTTTTCTGCT
                      ____________________________________________________________
consensus CCATATTTAGGTCACAGCGAATTGGGATGGTTCAAACATTGGAACAATATCTTTTCTGCT
 
. : . : . : . : . : . :
rJMSF046D04+ ACGATGCAATTATTGAGGAACTGGAAGACATCATCAAGGAAAGCACTGGACAACCAAGCT
rJMFF028L08+ ACGATGCAATTATTGAGGAACTGGAAGACATCATCAAGGAAAGCACTGGACAACCAAGCT
rJMFF050B17+ ACGATGCAATTATTGAGGAACTGGAAGACATCATCAAGGAAAGCACTGGACAACCAAGCT
                      ____________________________________________________________
consensus ACGATGCAATTATTGAGGAACTGGAAGACATCATCAAGGAAAGCACTGGACAACCAAGCT
 
. : . : . : . : . : . :
rJMSF046D04+ CTTAATCGATTGAAACGACGTTCAAGTAGAAGTTGAAGCTTCTTCGTAGCCCAATCGTGC
rJMFF028L08+ CTTAATCGATTGAAACGACGTTCAAGTAGAAGTTGAAGCTTCTTCGTAGCCCAATCGTGC
rJMFF050B17+ CTTAATCGATTGAAACGACGTTCAAGTAGAAGTTGAAGCTTCTTCGTAGCCCAATCGTGC
                      ____________________________________________________________
consensus CTTAATCGATTGAAACGACGTTCAAGTAGAAGTTGAAGCTTCTTCGTAGCCCAATCGTGC
 
. : . : . : . : . : . :
rJMSF046D04+ CTTCTTCCCCTGGGAATGAAGCAACAAGTTGAGCTGAAGATGTGTGGTATCATTATCGCG
rJMFF028L08+ CTTCTTCCCCTGGGAATGAAGCAACAAGTTGAGCTGAAGATGTGTGGTATCATTATCGCG
rJMFF050B17+ CTTCTTCCCCTGGGAATGAAGCAACAAGTTGAGCTGAAGATGTGTGGTATCATTATCGCG
                      ____________________________________________________________
consensus CTTCTTCCCCTGGGAATGAAGCAACAAGTTGAGCTGAAGATGTGTGGTATCATTATCGCG
 
. : . : . : . : . : . :
rJMSF046D04+ GAGTTTTGTCCAGTTCTGGGTCTGCTTGGCCAGAGACATGAAACTGTGATCAAAACAGTC
rJMFF028L08+ GAGTTTTGTCCAGTTCTGGGTCTGCTTGGCCAGAGACATGAAACTGTGATCAAAACAGTC
rJMFF050B17+ GAGTTTTGTCCAGTTCTGGGTCTGCTTGGCCAGAGACATGAAACTGTGATCAAAACAGTC
                      ____________________________________________________________
consensus GAGTTTTGTCCAGTTCTGGGTCTGCTTGGCCAGAGACATGAAACTGTGATCAAAACAGTC
 
. : . : . : . : . : . :
rJMSF046D04+ CTTTATTCTCTAAATATAAAATTTCCAGAGCTGGAACTTATTGAGATGCTCATGCATTTT
rJMFF028L08+ CTTTATTCTCTAAATATAAAATTTCCAGAGCTGGAACTTATTGAGATGCTCATGCATTTT
rJMFF050B17+ CTTTATTCTCTAAATATAAAATTTCCAGAGCTGGAACTTATTGAGATGCTCATGCATTTT
                      ____________________________________________________________
consensus CTTTATTCTCTAAATATAAAATTTCCAGAGCTGGAACTTATTGAGATGCTCATGCATTTT
 
. : . : . : . : . : . :
rJMSF046D04+ TACTCTGGCATGGATAAAATTGTTTTTGATATTTAAAGAAGGCAGTAATTTGTACCTCTC
rJMFF028L08+ TACTCTGGCATGGATAAAATTGTTTTTGATATTTAAAGAAGGCAGTAATTTGTACCTCTC
rJMFF050B17+ TACTCTGGCATGGATAAAATTGTTTTTGATATTTAAAGAAGGCAGTAATTTGTACCTCTC
                      ____________________________________________________________
consensus TACTCTGGCATGGATAAAATTGTTTTTGATATTTAAAGAAGGCAGTAATTTGTACCTCTC
 
. : . : . : . : . : . :
rJMSF046D04+ CTATAAACACTTT
rJMFF028L08+ CTATAAACACTTTTCAAAATGCTCCA
rJMFF050B17+ CTATAAACACTTTTCAAAATGCTCCATGAAATAAAAATCTAAAATGACTTAAAAAAAAAG
                      ____________________________________________________________
consensus CTATAAACACTTTTCAAAATGCTCCATGAAATAAAAATCTAAAATGACTTAAAAAAAAAG