Previous Contig 010947:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001B04Sequence201010947 (14)726010947 (14)gb:AF213937_17778074e-71Prunus dulcis 1-acyl-sn-glycerol-3-phosphate acyltransferase mRNA, complete cds.
JMFF007F22Sequence615010947 (14)gb:AY616009_16181362e-69Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp844010947 (14)gb:AF213937_17778073e-71Prunus dulcis 1-acyl-sn-glycerol-3-phosphate acyltransferase mRNA, complete cds.
JMFF013I07Sequence648010947 (14)gb:AF213937_17778071e-38Prunus dulcis 1-acyl-sn-glycerol-3-phosphate acyltransferase mRNA, complete cds.
JMFF016P10Sequence474010947 (14)gb:AY616009_16181369e-57Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp650010947 (14)gb:AY616009_16181363e-53Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp
JMFF033H22Sequence513010947 (14)gb:AY616009_16181363e-45Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp779010947 (14)gb:AY616009_16181366e-59Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp
JMFF049P17Sequence628010947 (14)gb:AY616009_16181363e-71Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp571010947 (14)gb:AF213937_17778074e-17Prunus dulcis 1-acyl-sn-glycerol-3-phosphate acyltransferase mRNA, complete cds.
JMFN028N05Sequence618010947 (14)gb:AY616009_16181365e-90Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp
JMSF017J11Sequence504010947 (14)gb:AY616009_16181364e-66Brassica oleracea acyl-CoA:1-acylglycerol-3-phosphate acyltransferase mRNA, comp745010947 (14)gb:AF213937_17778072e-72Prunus dulcis 1-acyl-sn-glycerol-3-phosphate acyltransferase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033H22- AAAATATTTTATTCAG
                      ____________________________________________________________
consensus AAAATATTTTATTCAG
 
. : . : . : . : . : . :
JMFF001B04- AAAGAAAATTACGGAGTGAGTAATTCATTTCGTCATGTA
JMFF033H22- GTAGAGTAGAGAAAAAGCAGAAAAGAAAATTACGGAGTGAGTAATTCATTTCGTCATGTA
JMFF007F22- GAGTAATTCATTTCGTCATGTA
JMFF049P17- GAGTAATTCATTTCGTCATGTA
                      ____________________________________________________________
consensus GTAGAGTAGAGAAAAAGCAGAAAAGAAAATTACGGAGTGAGTAATTCATTTCGTCATGTA
 
. : . : . : . : . : . :
JMFF001B04- TCTTTAAATCCGCCGTATCATCTGCGCATGTAAATCTGCTTCTATACTTACACACACAAG
JMFF033H22- TCTTTAAATCCGCCGTATCATCTGCGCATGTAAATCTGCTTCTATACTTACACACACAAG
JMSF017J11- ATACTTACACACACAAG
JMFF016P10- GCTTCTATACTTACACACACAAG
JMFF007F22- TCTTTAAATCCGCCGTATCATCTGCGCATGTAAATCTGCTTCTATACTTACACACACAAG
JMFF049P17- TCTTTAAATCCGCCGTATCATCTGCGCATGTAAATCTGCTTCTATACTTACACACACAAG
                      ____________________________________________________________
consensus TCTTTAAATCCGCCGTATCATCTGCGCATGTAAATCTGCTTCTATACTTACACACACAAG
 
. : . : . : . : . : . :
JMFF001B04- TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
JMFF033H22- TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
JMSF017J11- TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
JMFF016P10- TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
JMFF007F22- TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
JMFF049P17- TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
JMFN028N05- GGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
                      ____________________________________________________________
consensus TAGTGATTTTCGGTTGAGTTTTGGGAGCTCGGCCATGGCGATTGCAGCTGCAGCTGTTAT
 
. : . : . : . : . : . :
JMFF001B04- CGTCCCGTTGGGCGTTCTCTTTTTTATCTCGGGTCTCTTCAC
JMFF033H22- CGTCCCGTTGGGCGTTCTCTTTTTTATCTCGGGTCTCTTCACCAATCTCATTCAGGCTAT
JMSF017J11- CGTCCCGTTGGGCGTTCTCTTTTTTATCTCGGGTCTCTTCACCAATCTCATTCAGGCTAT
JMFF016P10- CGTCCCGTTGGGCGTTCTCTTTTTTATCTCGGGTCTCTTCACCAATCTCATTCAGGCTAT
JMFF007F22- CGTCCCGTTGGGCGTTCTCTTTTTTATCTC-GGTCTCTTCACCAATCTCATTCAGGCTAT
JMFF049P17- CGTCCCGTTGGGCGTTCTCTTTTTTATCTC-GGTCTCTTCACCAATCTCATTCAGGCTAT
JMFN028N05- CGTCCCGTTGGGCGTTCTCTTTTTTATCTCGGGTCTCTTCACCAATCTCATTCAGGCTAT
                      ____________________________________________________________
consensus CGTCCCGTTGGGCGTTCTCTTTTTTATCTCGGGTCTCTTCACCAATCTCATTCAGGCTAT
 
. : . : . : . : . : . :
JMFF033H22- ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
JMSF017J11- ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
JMFF016P10- ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
JMFF007F22- ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
JMFF049P17- ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
JMFN028N05- ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
                      ____________________________________________________________
consensus ATGCTTTGTTCTTATACGGCCATTGTCGAAGAACACATACAGGAGGATTAACAGGGTGTT
 
. : . : . : . : . : . :
JMFF033H22- TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTGATTGGTGGGCGGGTGTCAAGGT
JMSF017J11- TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTGATTGGTGGGCGGGTGTCAAGGT
JMFF016P10- TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTGATTGGTGGGCGGGTGTCAAGGT
JMFF007F22- TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTTATTGGTGGGCGGGTGTCAAGGT
JMFF049P17- TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTTATTGGTGGGCGGGTGTCAAGGT
JMFN028N05- TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTGATTGGTGGGCGGGTGTCAAGGT
                      ____________________________________________________________
consensus TGCAGAACTGTTGTGGCTTGAGCTCATTTGGCTTGTTGATTGGTGGGCGGGTGTCAAGGT
 
. : . : . : . : . : . :
JMFF033H22- TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
JMSF017J11- TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
JMFF016P10- TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
JMFF007F22- TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
JMFF049P17- TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
JMFN028N05- TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
                      ____________________________________________________________
consensus TAAATTATACACAGACCCCGAGACAGTTAAACTGATGGGTAAAGAACATGCTCTTGTAAT
 
. : . : . : . : . : . :
JMFF033H22- ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCAGCGATCAGG
JMSF017J11- ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCAGCGATCAGG
JMFF016P10- ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCANCGATCANG
JMFF007F22- ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCAGCGATCAGG
JMFF049P17- ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCAGCGATCAGG
JMFN028N05- ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCAGCGATCAGG
                      ____________________________________________________________
consensus ATCAAATCACAAAAGTGACATAGATTGGCTTGTTGGATGGGTGTTAGCTCAGCGATCAGG
 
. : . : . : . : . : . :
JMFF033H22- TTGCCTTGGTAGCACAT
JMSF017J11- TTGCCTTGGTAGCACATTAGCTGTAATGAAGAAATCATCCAAACTCCTTCCAGTTATTGG
JMFF016P10- TTGCCTTGGTAGCACATTANCTGTAATGAAGAAATCATCCAAACTCCTTCCAGNTATTGG
JMFF007F22- TTGCCTTGGTAGCACATTAGCTGTAATGAAGAAATCATCCAAACTCCTTCCAGTTATTGG
JMFF049P17- TTGCCTTGGTAGCACATTAGCTGTAATGAAGAAATCATCCAAACTCCTTCCAGTTATTGG
JMFN028N05- TTGCCTTGGTAGCACATTAGCTGTAATGAAGAAATCATCCAAACTCCTTCCAGTTATTGG
                      ____________________________________________________________
consensus TTGCCTTGGTAGCACATTAGCTGTAATGAAGAAATCATCCAAACTCCTTCCAGTTATTGG
 
. : . : . : . : . : . :
JMSF017J11- ATGGTCCATGTGGTTTTCTGAGTATCTTTTCCTTGAAAGAAGTTGGGCCAAGGATGAAAC
JMFF016P10- ATGGTCCATGTGGNTTTCTGAGTATCTTTTC
JMFF007F22- ATGGTCCATGTGGTTTTCTGAGTATCTTTTCCTTGAAAGAAGTTGGGCCAAGGATGAAAC
JMFF049P17- ATGGTCCATGTGGTTTTCTGAGTATCTTTTCCTTGAAAGAAGTTGGGCCAAGGATGAAAC
JMFN028N05- ATGGTCCATGTGGTTTTCTGAGTATCTTTTCCTTGAAAGAAGTTGGGCCAAGGATGAAAC
                      ____________________________________________________________
consensus ATGGTCCATGTGGTTTTCTGAGTATCTTTTCCTTGAAAGAAGTTGGGCCAAGGATGAAAC
 
. : . : . : . : . : . :
JMSF017J11- TACATT
JMFF007F22- TACATTAAAGTCAGGTCTT
JMFF049P17- TACATTANAGTCAGGTCTTCAACAGTTACGTGATTATCCACTGCCTTTTTGGTTGGCACT
JMFN028N05- TACATTAAAGTCAGGTCTTCAACAGTTACGTGATTATCCACTGCCTTTTTGGTTGGCACT
                      ____________________________________________________________
consensus TACATTAAAGTCAGGTCTTCAACAGTTACGTGATTATCCACTGCCTTTTTGGTTGGCACT
 
. : . : . : . : . : . :
JMFF049P17- TTTTGTT
JMFN028N05- TTTTGTTGAAGGTACTCGCTTCACACAGGCAAAGCTTTTAGCTGCTCAAGAGTATGCTAC
rJMFF001B04+ TTAGCTGCTCAAGAGTATGCTAC
rJMSF017J11+ TTTTAGCTGCTCAAGAGTATGCTAC
rJMFF007F22+ TTAGCTGCTCAAGAGTATGCTAC
                      ____________________________________________________________
consensus TTTTGTTGAAGGTACTCGCTTCACACAGGCAAAGCTTTTAGCTGCTCAAGAGTATGCTAC
 
. : . : . : . : . : . :
JMFN028N05- CTCAACAGGCTTACCTGTTCCAAGAAA
rJMFF001B04+ CTCAACAGGCTTACCTGTTCCAAGAAATGTTTTAATTCCTCGTACTAAGGGTTTTGTTAC
rJMSF017J11+ CTCAACAGGCTTACCTGTTCCAAGAAATGTTTTAATTCCTCGTACTAAGGGTTTTGTTAC
rJMFF033H22+ TACTAAGGGTTTTGTTAC
rJMFF007F22+ CTCAACAGGCTTACCTGTTCCAAGAAATGTTTTAATTCCTCGTACTAAGGGTTTTGTTAC
                      ____________________________________________________________
consensus CTCAACAGGCTTACCTGTTCCAAGAAATGTTTTAATTCCTCGTACTAAGGGTTTTGTTAC
 
. : . : . : . : . : . :
rJMFF001B04+ GGCGGTAAGTCACATGC-GATCATTTGTTCCTGCAATATATGAGATGACAGTAGCCATTC
rJMSF017J11+ GGCGGTAAGTCACATGC-GATCATTTGTTCCTGCAATATATGAGATGACAGTAGCCATTC
rJMFF033H22+ GGCGGTAAGTCACATGC-GATCATTTGTTCCTGCAATATATGAGATGACAGTAGCCATTC
rJMFF016P10+ CGGTAAGTCACATGCGGATCATTTGTTCCTGCAATATATGAGATGACAGTAGCCATTC
rJMFF007F22+ GGCGGTAAGTCACATGC-GATCATTTGTTCCTGCAATATATGAGATGACAGTAGCCATTC
                      ____________________________________________________________
consensus GGCGGTAAGTCACATGC-GATCATTTGTTCCTGCAATATATGAGATGACAGTAGCCATTC
 
. : . : . : . : . : . :
rJMFF001B04+ CTAAGAGTTCTCCACCACCAACAATGCTACGGATTTTCAAGGGGAAATCCTCTGTGGTCC
rJMSF017J11+ CTAAGAGTTCTCCACCACCAACAATGCTACGGATTTTCAAGGGGAAATCCTCTGTGGTCC
rJMFF033H22+ NTAAGAGTTCTCCACCACCAACAATGCTACGGATTTTCAAGGGGAAATCCTCTGTGGTCC
rJMFF016P10+ NTAAGAGTTCTCCACCACCAACAATGCTACGGATTTTCAAGGGGAAATCCTCTGTGGTCC
rJMFF007F22+ CTAAGAGTTCTCCACCACCAACAATGCTACGGATTTTCAAGGGGAAATCCTCTGTGGTCC
rJMFF013I07+ GTCC
                      ____________________________________________________________
consensus CTAAGAGTTCTCCACCACCAACAATGCTACGGATTTTCAAGGGGAAATCCTCTGTGGTCC
 
. : . : . : . : . : . :
rJMFF001B04+ ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
rJMSF017J11+ ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
rJMFF033H22+ ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
rJMFF016P10+ ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
rJMFF007F22+ ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
rJMFF013I07+ ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
                      ____________________________________________________________
consensus ATGTTCACCTCAAGCGACACTTAATGAAGGATCTGCCAGAAAATGATGATGATGTTGCTC
 
. : . : . : . : . : . :
rJMFF001B04+ AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
rJMSF017J11+ AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
rJMFF033H22+ AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
rJMFF016P10+ AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
rJMFF007F22+ AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
rJMFF013I07+ AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
rJMFF049P17+ AGGACAATTTATTGGATAAACATAATGCTGAAG
                      ____________________________________________________________
consensus AGTGGTGTAGGGATGCCTTTGTGGCAAAGGACAATTTATTGGATAAACATAATGCTGAAG
 
. : . : . : . : . : . :
rJMFF001B04+ ACACCTTTGGACGAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
rJMSF017J11+ ACACCTTTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
rJMFF033H22+ ACACCTTTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
rJMFF016P10+ ACACCTTTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
rJMFF007F22+ ACACCTTTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
rJMFF013I07+ ACACCTTTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
rJMFF049P17+ ACACC-TTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
                      ____________________________________________________________
consensus ACACCTTTGGACAAGAGCTGGAGCGAGATCTTGGCAGGCCAGTGAAATCACTTGTGGTGG
 
. : . : . : . : . : . :
rJMFF001B04+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
rJMSF017J11+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
rJMFF033H22+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
rJMFF016P10+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
rJMFF007F22+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
rJMFF013I07+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
rJMFF049P17+ TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
                      ____________________________________________________________
consensus TTGTGTCGTGGGCATGTCTGCTAATTCTAGGAGCGGTAAAATTCTTCCAGTCTTCGGGGC
 
. : . : . : . : . : . :
rJMFF001B04+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
rJMSF017J11+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
rJMFF033H22+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
rJMFF016P10+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
rJMFF007F22+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
rJMFF013I07+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
rJMFF049P17+ TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
                      ____________________________________________________________
consensus TTCTATCGTCATGGAAAGGCCTATCAATTTCAGCAGCTCTCCTGGGAGTTGTTACAATTC
 
. : . : . : . : . : . :
rJMFF001B04+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
rJMSF017J11+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
rJMFF033H22+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
rJMFF016P10+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
rJMFF007F22+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
rJMFF013I07+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
rJMFF049P17+ TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
                      ____________________________________________________________
consensus TCATGCAGATACTGATTAAATTCTCTCAGGCTGAGCGATCGGTGCCCGCAAAAGTTGCAC
 
. : . : . : . : . : . :
rJMFF001B04+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
rJMSF017J11+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
rJMFF033H22+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
rJMFF016P10+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
rJMFF007F22+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
rJMFF013I07+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
rJMFF049P17+ CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
                      ____________________________________________________________
consensus CCGCAAGTACAAACACCAGTAATCAAGTTGCATCAGACAGTAGAAAACGAAAAGAGCAGT
 
. : . : . : . : . : . :
rJMFF001B04+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
rJMSF017J11+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
rJMFF033H22+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
rJMFF016P10+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
rJMFF007F22+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
rJMFF013I07+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
rJMFF049P17+ GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
                      ____________________________________________________________
consensus GATCCATCTTTATTTCTGTCTTTCTCTCAGATAGTTATGACCCCTCCCCTCTCCTCTCCT
 
. : . : . : . : . : . :
rJMFF001B04+ CCCTGGATTTCCAAAGTTGAAG-TGAA-CATGATGTATGTATTA
rJMSF017J11+ CCCTGGATTTCCAAAGTTGAAGTTGAACCATGATGTATGTATTATGTAATCTCTA
rJMFF033H22+ CCCTGGATTTCCAAAGTTGAAGTTGAA-CATGATGTATGTATTATGTAATCTCTATTATT
rJMFF016P10+ CCCTGGATTTCCAAAGTTGAAGTTGAA-CATGATGTATGTATTATGTAATCTC
rJMFF007F22+ CCCTGGATTTCCAAAGTTGAAGTTGAA-CATGATGTATGTATTATGTAATCTCTATTATT
rJMFF013I07+ CCCTGGATTTCCAAAGTTGAAGTTGAA-CATGATGTATGTATTATGTAATCTCTATTATT
rJMFF049P17+ CCCTGGATTTCCAAAGTTGAAGTTGAA-CATGATGTATGTATTATGTAATCTCTATTATT
                      ____________________________________________________________
consensus CCCTGGATTTCCAAAGTTGAAGTTGAA-CATGATGTATGTATTATGTAATCTCTATTATT
 
. : . : . : . : . : . :
rJMFF033H22+ GTGTACTGAGTTGAGTTGAGTTGTTTCTGTGTCTCTCTCTCAACTTGTCTTGCTGCCCAA
rJMFF007F22+ GTGTACTGAGTTGAGTTGAGTTGTTTCTGTGTCTCTCTCTCAACTTGTCTTGCTGCCCAA
rJMFF013I07+ GTGTACTGAGTTGAGTTGAGTTGTTTCTGTGTCTCTCTCTCAACTTGTCTTGCTGCCCAA
rJMFF049P17+ GTGTACTGAGTTGAGTTGAGTTGTTTCTGTGTCTCTCTCTCAACTTGTCTTGCTGCCCAA
                      ____________________________________________________________
consensus GTGTACTGAGTTGAGTTGAGTTGTTTCTGTGTCTCTCTCTCAACTTGTCTTGCTGCCCAA
 
. : . : . : . : . : . :
rJMFF033H22+ TATGACCACCACGTTTGTGATTTTAAGCATTTGAGATAC
rJMFF007F22+ TATGACCACCACGTTTGTGATTTTAAGCATTTGAGATAC
rJMFF013I07+ TATGACCACCACGTTTGTGATTTTAAGCATTTGAGATAC
rJMFF049P17+ TATGACCACCACGTTTGTGATTTTAAGCATTTGAGATACAGATTTTACTTTACATTTATT
                      ____________________________________________________________
consensus TATGACCACCACGTTTGTGATTTTAAGCATTTGAGATACAGATTTTACTTTACATTTATT