Previous Contig 010933:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031H16Sequence586010933 (4)gb:AE005173_8950972e-43Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC006434_153764010933 (4)gb:AE005173_8950971e-20Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC006434_153
JMFF049N14Sequence644010933 (4)gb:AE005173_8950972e-43Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC006434_153412010933 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031H16- CTC
                      ____________________________________________________________
consensus CTC
 
. : . : . : . : . : . :
JMFF031H16- ACTTTCTCAATTCTCACCGTCAACGGAGACAGTCATTCAAAGCGAAACATCGTCGGAGAA
JMFF049N14- GTCGGAGAA
                      ____________________________________________________________
consensus ACTTTCTCAATTCTCACCGTCAACGGAGACAGTCATTCAAAGCGAAACATCGTCGGAGAA
 
. : . : . : . : . : . :
JMFF031H16- ATCATTTTCTGAAAAAAACAGAAAAAAAAATCGTTTTTTCGATCAATTAAGAAGAAAGAA
JMFF049N14- ATCATTTTCTGAAAAAAACAGAAAAAAAAATCGTTTTTTCGATCAATTAAGAAGAAAGAA
                      ____________________________________________________________
consensus ATCATTTTCTGAAAAAAACAGAAAAAAAAATCGTTTTTTCGATCAATTAAGAAGAAAGAA
 
. : . : . : . : . : . :
JMFF031H16- ATGTCTGGGTGCAGCAGAATCCAGCACATTGTGAGGCTCCGGCAGATGATCCGGTGGTGG
JMFF049N14- ATGTCTGGGTGCAGCAGAATCCAGCACATTGTGAGGCTCCGGCAGATGATCCGGTGGTGG
                      ____________________________________________________________
consensus ATGTCTGGGTGCAGCAGAATCCAGCACATTGTGAGGCTCCGGCAGATGATCCGGTGGTGG
 
. : . : . : . : . : . :
JMFF031H16- CGCAAGAAGGCGGCAATGGCGGCCCGCAGCCGCGTCCCGGCCGATGTCCCCGCCGGACAC
JMFF049N14- CGCAAGAAGGCGGCAATGGCGGCCCGCAGCCGCGTCCCGGCCGATGTCCCCGCCGGACAC
                      ____________________________________________________________
consensus CGCAAGAAGGCGGCAATGGCGGCCCGCAGCCGCGTCCCGGCCGATGTCCCCGCCGGACAC
 
. : . : . : . : . : . :
JMFF031H16- GTGGCGATCACGGTCGGGACGAACAGCAAACGGTTCGTGGTCCGCGCCACGTACCTGAAC
JMFF049N14- GTGGCGATCACGGTCGGGACGAACAGCAAACGGTTCGTGGTCCGCGCCACGTACCTGAAC
                      ____________________________________________________________
consensus GTGGCGATCACGGTCGGGACGAACAGCAAACGGTTCGTGGTCCGCGCCACGTACCTGAAC
 
. : . : . : . : . : . :
JMFF031H16- CACCCGGTCTTCAAGAAGCTACTGTCGCAGGCGGAAGAAGAGTACGGGTTTACCAACTCC
JMFF049N14- CACCCGGTCTTCAAGAAGCTACTGTCGCAGGCGGAAGAAGAGTACGGGTTTACCAACTCC
rJMFF031H16+ AAGAAGAGTACGGGTTTACCAACTCC
                      ____________________________________________________________
consensus CACCCGGTCTTCAAGAAGCTACTGTCGCAGGCGGAAGAAGAGTACGGGTTTACCAACTCC
 
. : . : . : . : . : . :
JMFF031H16- GGGCCGTTAGCCATTCCCTGCGACGAGTCGGTGTTCGAGGAAATTCTCCGGTATTTGACC
JMFF049N14- GGGCCGTTAGCCATTCCCTGCGACGAGTCGGTGTTCGAGGAAATTCTCCGGTATTTGACC
rJMFF031H16+ GGGCCGTTAGCCATTCCCTGCGACGAGTCGGTGTTCGAGGAAATTCTCCGGTATTTGACC
                      ____________________________________________________________
consensus GGGCCGTTAGCCATTCCCTGCGACGAGTCGGTGTTCGAGGAAATTCTCCGGTATTTGACC
 
. : . : . : . : . : . :
JMFF031H16- CGATCCGAATCCGATCACAAGACCCGGTTCATGAACTACGAGGACTTCCAGAGATACTGC
JMFF049N14- CGATCCGAATCCGATCACAAGACCCGGTTCATGAACTACGAGGACTTCCAGAGATACTGC
rJMFF031H16+ CGATCCGAATCCGATCACAAGACCCGGTTCATGAACTACGAGGACTTCCAGAGATACTGC
                      ____________________________________________________________
consensus CGATCCGAATCCGATCACAAGACCCGGTTCATGAACTACGAGGACTTCCAGAGATACTGC
 
. : . : . : . : . : . :
JMFF031H16- CACGTCGGCATCCGAAGCAACCTTGAATTCTGGGGCGAGTCACGCCCGCTCTTACATGGC
JMFF049N14- CACGTCGGCATCCGAAGCAACCTTGAATTCTGGGGCGAGTCACGCCCGCTCTTACATGGC
rJMFF031H16+ CACGTCGGCATCCGAAGCAACCTTGAATTCTGGGGCGAGTCACGCCCGCTCTTACATGGC
                      ____________________________________________________________
consensus CACGTCGGCATCCGAAGCAACCTTGAATTCTGGGGCGAGTCACGCCCGCTCTTACATGGC
 
. : . : . : . : . : . :
JMFF031H16- GTTTCCGGTAAATCGATATGCTAATGCCCCGGGGGGTCGTTTG
JMFF049N14- GTTTCCGGTAAATCGATATGCTAATGCCCCGGGGGGTCGTTTGGTTCCGAGTTTAGGAAT
rJMFF031H16+ GTTTCCGGTAAATCGATATGCTAATGCCCCGGGGGGTCGTTTGGTTCCGAGTTTAGGAAT
                      ____________________________________________________________
consensus GTTTCCGGTAAATCGATATGCTAATGCCCCGGGGGGTCGTTTGGTTCCGAGTTTAGGAAT
 
. : . : . : . : . : . :
JMFF049N14- CGGCAGTGATTTAAGTCAGATAACCGGAATTCGTGATTTCATTTTGCGGAAA-CAAACGC
rJMFF031H16+ CGGCAGTGATTTAAGTCAGATAACCGGAATTCGTGATTTCATTTTGCGGAAACCAAACGC
                      ____________________________________________________________
consensus CGGCAGTGATTTAAGTCAGATAACCGGAATTCGTGATTTCATTTTGCGGAAACCAAACGC
 
. : . : . : . : . : . :
JMFF049N14- GTACTATNAGGAC-AGTATATGATATGATATGACAG
rJMFF031H16+ GTACTAT-AGGACAAGTATATGATATGATATGACAGACATTATTGGATGGAGAAAATAAA
                      ____________________________________________________________
consensus GTACTATNAGGACAAGTATATGATATGATATGACAGACATTATTGGATGGAGAAAATAAA
 
. : . : . : . : . : . :
rJMFF031H16+ GAAACACTGCAACACTATCGGTGCTCCGATTTGACTCGTCCGAGTTGCACTGCCGGCACG
                      ____________________________________________________________
consensus GAAACACTGCAACACTATCGGTGCTCCGATTTGACTCGTCCGAGTTGCACTGCCGGCACG
 
. : . : . : . : . : . :
rJMFF031H16+ GCGGTCAACGCGCTTGACTCGGTTGACTACTCCGTTTTAGGACGGTGATACATTTTTCTT
rJMFF049N14+ CGCGCTTGACTCGGTTGACTACTCCGTTTTAGGACGGTGATACATTTTTCTT
                      ____________________________________________________________
consensus GCGGTCAACGCGCTTGACTCGGTTGACTACTCCGTTTTAGGACGGTGATACATTTTTCTT
 
. : . : . : . : . : . :
rJMFF031H16+ ACCATATTGGTAAGTGGGAAATGAAGTAATTTTTGTATTTATCTCTTTTTCTTTTTTTAT
rJMFF049N14+ ACCATATTGGTAAGTGGGAGATGAAGTAATTTTGGTATTTATCTCTTTTTCTTTTTTTAT
                      ____________________________________________________________
consensus ACCATATTGGTAAGTGGGAGATGAAGTAATTTTTGTATTTATCTCTTTTTCTTTTTTTAT
 
. : . : . : . : . : . :
rJMFF031H16+ TTTCGGTGAATACTCCGGAGAATGTGATGGAGATGGCAACCGAGTCGTCCCGAGTTCGAA
rJMFF049N14+ TTTCGGGGAATACTCCGGAGAATGTGATGGAGATGGCAACCGAGTCGTCCCGAGTTCGAA
                      ____________________________________________________________
consensus TTTCGGTGAATACTCCGGAGAATGTGATGGAGATGGCAACCGAGTCGTCCCGAGTTCGAA
 
. : . : . : . : . : . :
rJMFF031H16+ TCTGATGGAGTCAAGAAAATCAAAGACTCCACGGCGGCGGCAAGAAGCGGCGGAGATGAT
rJMFF049N14+ TCTGATGGAGTCAAGAAAATCAAAGACTCCCCGGCGGCGGCAAGAAGCGGCGGAGATGAT
                      ____________________________________________________________
consensus TCTGATGGAGTCAAGAAAATCAAAGACTCCCCGGCGGCGGCAAGAAGCGGCGGAGATGAT
 
. : . : . : . : . : . :
rJMFF031H16+ CTGATCTGATGACTGTAATGGCCATATTCCATCGTCTTGTAAATTGATGATTGGAAAATA
rJMFF049N14+ CTGATCTGATGACTGTAATGGCCATATTCCATCGTCTTGTAAATTGATGATTGGAAAATA
                      ____________________________________________________________
consensus CTGATCTGATGACTGTAATGGCCATATTCCATCGTCTTGTAAATTGATGATTGGAAAATA
 
. : . : . : . : . : . :
rJMFF031H16+ TGTAGAAATCGAGATATTT
rJMFF049N14+ TGTAGAAATCGAGATATTTTGTAATTTTTTTCTTGTTGGAATTCATTGTTATTGATAATT
                      ____________________________________________________________
consensus TGTAGAAATCGAGATATTTTGTAATTTTTTTCTTGTTGGAATTCATTGTTATTGATAATT
 
. : . : . : . : . : . :
rJMFF049N14+ CTTCTCCCXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAG
                      ____________________________________________________________
consensus CTTCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAG