Previous Contig 010930:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022K19Sequence462001120 (4)gb:AB009053_15106845e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQB2.603010930 (3)gb:AP003076_18246502e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048
JMFF049M13Sequence493000376 (28)gb:AF304374_17843854e-50Nicotiana alata cellulose synthase catalytic subunit (CesA1) mRNA, complete cds.467010930 (3)
JMFF050A17Sequence636000376 (28)gb:AY573572_16158363e-60Populus tremula x Populus tremuloides cellulose synthase (CesA2) mRNA, complete 614010930 (3)gb:AP003076_18246501e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF022K19+ CCAAAGCCTTGGCACCTAGCAAGAAAGGGTG
rJMFF050A17+ TAGCAAGAAA-GGTG
                      ____________________________________________________________
consensus CCAAAGCCTTGGCACCTAGCAAGAAAGGGTG
 
. : . : . : . : . : . :
rJMFF022K19+ GNTAGAGGGCCAAGATTTGGACAAGAACAATTTGGCACTTTTNTANTGGTTTTTGGCCAT
rJMFF050A17+ GCTAGAGGGCCAAGATTTGGACAAGAACAATTTGGCACTTTTCTACTGGTTCTTGGCCAT
                      ____________________________________________________________
consensus GCTAGAGGGCCAAGATTTGGACAAGAACAATTTGGCACTTTTCTACTGGTTTTTGGCCAT
 
. : . : . : . : . : . :
rJMFF022K19+ TNTTAGCTGTTTCAACTTTGCAAACTATCTTTATTGGGCATTGTGGTACAAGTACAAACC
rJMFF050A17+ TCTTAGCTGTTTCAACTTTGCAAACTATCTTTATTGGGCATTGTGGTACAAGTACAAACC
                      ____________________________________________________________
consensus TCTTAGCTGTTTCAACTTTGCAAACTATCTTTATTGGGCATTGTGGTACAAGTACAAACC
 
. : . : . : . : . : . :
rJMFF022K19+ CCAAAACAACCCAAACCCCAACCCAAACCCCAAACCCAAACCATCATCAGATCCAGATAC
rJMFF050A17+ CCAAAACAACCCAAACCCCAACCCAAACCCCAAACCCAAACCATCATCAGATCCAGATAC
rJMFF049M13+ AACCCCAACCCAAACCCCAAACCCAAACCATCATCAGATCCAGATAC
                      ____________________________________________________________
consensus CCAAAACAACCCAAACCCCAACCCAAACCCCAAACCCAAACCATCATCAGATCCAGATAC
 
. : . : . : . : . : . :
rJMFF022K19+ TTTGCCCAAATCACTNTNTTTAAGTAGGGTGCCATTCCTCAAGGCCTNTGGAGATAATGA
rJMFF050A17+ TTTGCCCAAATCACTCTCTCTAAGTAGGGTGCCATTCCTCAAGGCCTCTGGAGATAATGA
rJMFF049M13+ TTTGCCCAAATCACTCTCTCTAAGTAGGGTGCCATTCCTCAAGGCCTCTGGAGATAATGA
                      ____________________________________________________________
consensus TTTGCCCAAATCACTCTCTCTAAGTAGGGTGCCATTCCTCAAGGCCTCTGGAGATAATGA
 
. : . : . : . : . : . :
rJMFF022K19+ TAATCCATNTCAAACTACGGTTAAATCGCTATNTACTCCCCAGTAATGGGAAAAGTTCAA
rJMFF050A17+ TAATCCATCTCAAACTACGGTTAAATCGCTATCTACTCCCCAGTAATGGGAAAAGTTCAA
rJMFF049M13+ TAATCCATCTCAAACTACGGTTAAATCGCTATCTACTCCCCAGTAATGGGAAAAGTTCAA
                      ____________________________________________________________
consensus TAATCCATCTCAAACTACGGTTAAATCGCTATCTACTCCCCAGTAATGGGAAAAGTTCAA
 
. : . : . : . : . : . :
rJMFF022K19+ GAAAGCCCAACCAGCTTCAATTCGTTGTGCCAATAAAAGCCCATGNTATTTCGTGGGCCT
rJMFF050A17+ GAAAGCCCAACCAGCTTCAATTCGTTGTGCCAATAAAAGCCCATGCTATTTCGTGGGCCT
rJMFF049M13+ GAAAGCCCAACCAGCTTCAATTCGTTGTGCCAATAAAAGCCCATGCTATTTCGTGGGCCT
                      ____________________________________________________________
consensus GAAAGCCCAACCAGCTTCAATTCGTTGTGCCAATAAAAGCCCATGCTATTTCGTGGGCCT
 
. : . : . : . : . : . :
rJMFF022K19+ AGTAATATATATATATATTAACATTTTTTTTTTGTTTTGCTTTTTGTTGAGTTCTTCTGG
rJMFF050A17+ AGTAATATATATATATATTAACATTTTTTTTTTGTTTTGCTTTTTGTTGAGTTCTTCTGG
rJMFF049M13+ AGTAATATATATATATATTAACATTTTTTTTTTGTTTTGCTTTTTGTTGAGTTCTTCTGG
                      ____________________________________________________________
consensus AGTAATATATATATATATTAACATTTTTTTTTTGTTTTGCTTTTTGTTGAGTTCTTCTGG
 
. : . : . : . : . : . :
rJMFF022K19+ GGTTTGTGTGTTTGATCTGAAATTTTTTGAGGGAAGGTTTAATTTGATTATGTGTACTTA
rJMFF050A17+ GGTTTGTGTGTTTGATCTGAAATTTTTTGAGGGAAGGTTTAATTTGATTATTTGTACTTA
rJMFF049M13+ GGTTTGTGTGTTTGATCTGAAATTTTTTGAGGGAAGGTTTAATTTGATTATTTGTACTTA
                      ____________________________________________________________
consensus GGTTTGTGTGTTTGATCTGAAATTTTTTGAGGGAAGGTTTAATTTGATTATTTGTACTTA
 
. : . : . : . : . : . :
rJMFF022K19+ GATGCATGCAATGTCTACTAGTATAAAATACGAAACAGATGTTTGTTTCATAAGTTGTAT
rJMFF050A17+ GATGCATGCAATGTCTACTAGTATAAAATACGAAACAGATGTTTGTTTCATAAGTTGTAT
rJMFF049M13+ GATGCATGCAATGTCTACTAGTATAAAATACGAAACAGATGTTTGTTTCATAAGTTGTAT
                      ____________________________________________________________
consensus GATGCATGCAATGTCTACTAGTATAAAATACGAAACAGATGTTTGTTTCATAAGTTGTAT
 
. : . : . : . : . : . :
rJMFF022K19+ GTATAAGGTCGTTACATGTAAAATAT
rJMFF050A17+ GTATAAGGTCGTTACATGTAAAATATTGAAGAATGTTTTCTAATGATACTAATTTCTTAC
rJMFF049M13+ GTATAAGGTCGTTACATGTAAAATATTGAAGAATGTTTTCTAATGATACTAATTTCTTAC
                      ____________________________________________________________
consensus GTATAAGGTCGTTACATGTAAAATATTGAAGAATGTTTTCTAATGATACTAATTTCTTAC