Previous Contig 010927:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049M01Sequence503002123 (8)pir|T02939|T029396e-26chloride channel protein ClC-1 - common tobacco>gb:NTCLCNT1_1691517 N.tabacum mR537010927 (3)
JMSF008L06Sequence402002123 (8)pir|T02939|T029392e-09chloride channel protein ClC-1 - common tobacco>gb:NTCLCNT1_1691517 N.tabacum mR774010927 (3)pir|T07608|T076083e-50chloride channel protein homolog CLC1 - potato>gb:STPUCHLCH_1722891 Solanum tube
JMSF029A03Sequence709002123 (8)pir|T02939|T029391e-58chloride channel protein ClC-1 - common tobacco>gb:NTCLCNT1_1691517 N.tabacum mR721010927 (3)pir|T07608|T076088e-51chloride channel protein homolog CLC1 - potato>gb:STPUCHLCH_1722891 Solanum tube

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029A03+ TGAATCA
rJMSF008L06+ TCA
                      ____________________________________________________________
consensus TGAATCA
 
. : . : . : . : . : . :
rJMSF029A03+ CCAGAGCTATATGGGCTTGTTCTTAGGTCACATCTGCTCGTTTTGCTGAATGGAAAGAAT
rJMSF008L06+ CCAGAGCTATATGGGCTTGTTCTTANGTCACATCTGCTCGTTTTGCTGAATGGAAAGAAT
                      ____________________________________________________________
consensus CCAGAGCTATATGGGCTTGTTCTTAGGTCACATCTGCTCGTTTTGCTGAATGGAAAGAAT
 
. : . : . : . : . : . :
rJMSF029A03+ TTCTCCAAACAGCAGGGGTTGATGGGCTCACAAATCTTGACGAGGTTTCACGCATTTGAT
rJMSF008L06+ TTCTCCAAACAGCAGGGGTTGATGGGCTCACAAATCTTGACGAGGTTTCACGCATTTGAT
                      ____________________________________________________________
consensus TTCTCCAAACAGCAGGGGTTGATGGGCTCACAAATCTTGACGAGGTTTCACGCATTTGAT
 
. : . : . : . : . : . :
rJMSF029A03+ TTTGCAAAGCCGGGTTTAGGAAAGGGGCTTAAAGTTGATGATTTGAATATCACGGAGGAG
rJMSF008L06+ TTTGCAAAGCCGGGTTTAGGAAAGGGGCTTAAAGTTGATGATTTGAATATCACGGAGGAG
                      ____________________________________________________________
consensus TTTGCAAAGCCGGGTTTAGGAAAGGGGCTTAAAGTTGATGATTTGAATATCACGGAGGAG
 
. : . : . : . : . : . :
rJMSF029A03+ GAGATGGAGATGTATGTTGATCTCCATCCTATCACAAATACGTCTCCTTACACTGTAGTG
rJMSF008L06+ GAGATGGAGATGTATGTTGATCTCCATCCTATCACAAATACGTCTCCTTACACTGTAGTG
                      ____________________________________________________________
consensus GAGATGGAGATGTATGTTGATCTCCATCCTATCACAAATACGTCTCCTTACACTGTAGTG
 
. : . : . : . : . : . :
rJMSF029A03+ GAGACGATGTCTCTGGCAAAAGCTGCAATACTCTTTCGAGAGCTTGGTCTCAGACACTTG
rJMSF008L06+ GAGACGATGTCTCTGGCAAAAGCTGCAATACTCTTTCGAGAGCTTGGTCTCAGACACTTG
                      ____________________________________________________________
consensus GAGACGATGTCTCTGGCAAAAGCTGCAATACTCTTTCGAGAGCTTGGTCTCAGACACTTG
 
. : . : . : . : . : . :
rJMSF029A03+ TGTGTTGTCCCAAAGCGACTTGGGAGACCACCAATTGTGGGAATCTTGACGCGACATGAT
rJMSF008L06+ TGTGTTGTCCCAAAGCGACTTGGGAGACCACCAATTGTGGGAATCTTGACGCGACATGAT
                      ____________________________________________________________
consensus TGTGTTGTCCCAAAGCGACTTGGGAGACCACCAATTGTGGGAATCTTGACGCGACATGAT
 
. : . : . : . : . : . :
rJMSF029A03+ TTCATGCCCGAGCATATCTTGGGACTCTACCCTAGCATCAATCCCCACGGCCATGGCTAG
rJMSF008L06+ TTCATGCCCGAGCATATCTTGGGACTCTACCCTAGCATCAATCCCCACGGCCATGGCTAG
rJMFF049M01+ ATGCCCGAGCATATCTTGGGACTCTACCCTAGCATCAATCCCCACGGCCATGGCTAG
                      ____________________________________________________________
consensus TTCATGCCCGAGCATATCTTGGGACTCTACCCTAGCATCAATCCCCACGGCCATGGCTAG
 
. : . : . : . : . : . :
rJMSF029A03+ TCGGGATTCGGTGAGTCTGCATTGGCAAAGGTCCCCATTATTCCCTTTTCTGAAGTTTCA
rJMSF008L06+ TCGGGATTCGGTGAGTCTGCATTGGCAAAGGTCCCCATTATTCCCTTTTCTGAAGTTTCA
rJMFF049M01+ TCGGGATTCGGTGAGTCTGCATTGGCAAAGGTCCCCATTATTCCCTTTTCTGAAGTTTCA
                      ____________________________________________________________
consensus TCGGGATTCGGTGAGTCTGCATTGGCAAAGGTCCCCATTATTCCCTTTTCTGAAGTTTCA
 
. : . : . : . : . : . :
rJMSF029A03+ GAGAGAACTTTGGTTATTTACATAGCATTGTGTTACTGTAACGGCATTGCGTTACATAGA
rJMSF008L06+ GAGAGAACTTTGGTTATTTACATAGCATTGTGTTACTGTAACGGCATTGCGTTACATAGA
rJMFF049M01+ GAGAGAACTTTGGTTATTTACATAGCATTGTGTTACTGTAACGGCATTGCGTTACATAGA
                      ____________________________________________________________
consensus GAGAGAACTTTGGTTATTTACATAGCATTGTGTTACTGTAACGGCATTGCGTTACATAGA
 
. : . : . : . : . : . :
rJMSF029A03+ ACATAATGGAGAAATAGAGTCAACGTACTAAACTGTCGCCGCATGCAAAACAAAGTTGTT
rJMSF008L06+ ACATAATGGAGAAATAGAGTCAACGTACTAAACTGTCGCCGCATGCAAAACAAAGTTGTT
rJMFF049M01+ ACATAATGGAGAAATAGAGTCAACGTACTAAACTGTCGCCGCATGCAAAACAAAGTTGTT
                      ____________________________________________________________
consensus ACATAATGGAGAAATAGAGTCAACGTACTAAACTGTCGCCGCATGCAAAACAAAGTTGTT
 
. : . : . : . : . : . :
rJMSF029A03+ TGTTTGTTTACGCATTCGTAGACAAACGTAAAAACAGTACGTAGTAATAATGTGGTCTCA
rJMSF008L06+ TGTTTGTTTACGCATTCGTAGACAAACGTAAAAACAGTACGTAGTAATAATGTGGTCTCA
rJMFF049M01+ TGTTTGTTTACGCATTCGTAGACAAACGTAAAAACAGTACGTAGTAATAATGTGGTCTCA
                      ____________________________________________________________
consensus TGTTTGTTTACGCATTCGTAGACAAACGTAAAAACAGTACGTAGTAATAATGTGGTCTCA
 
. : . : . : . : . : . :
rJMSF029A03+ TACTTCTGTAAGTTTATTCGTTTTCGAGTGCCAAATTAGCGCTCGTATATGTAT
rJMSF008L06+ TACTTCTGTAAGTTTATTCGTTTTCGAGTGCCAAATTAGCGCTCGTATATGTATTGAACT
rJMFF049M01+ TACTTCTGTAAGTTTATTCGTTTTCGAGTGCCAAATTAGCGCTCGTATATGTATTGAACT
                      ____________________________________________________________
consensus TACTTCTGTAAGTTTATTCGTTTTCGAGTGCCAAATTAGCGCTCGTATATGTATTGAACT
 
. : . : . : . : . : . :
rJMSF008L06+ GTGTAATATTTGTCGTTTTTGGGTGCGAAATGAGCAGTTGGGCACTAGTAT
rJMFF049M01+ GTGTAATATTTGTCGTTTTTGGGTGCGAAATGAGCAGTTGGGCACTAGTATTTGTATTGT
                      ____________________________________________________________
consensus GTGTAATATTTGTCGTTTTTGGGTGCGAAATGAGCAGTTGGGCACTAGTATTTGTATTGT
 
. : . : . : . : . : . :
rJMFF049M01+ AGTACTTAGTATTATTTATGTGAATTTATTTAATAATTTGACCTTGTTCTACTTAGTATT
                      ____________________________________________________________
consensus AGTACTTAGTATTATTTATGTGAATTTATTTAATAATTTGACCTTGTTCTACTTAGTATT
 
. : . : . : . : . : . :
rJMFF049M01+ ATTTATGTGAATTTATTTAATAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATTTATGTGAATTTATTTAATAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG