Previous Contig 010926:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002K16Sequence561002122 (2)gb:OSA312313_16925164e-18Oryza sativa putative B'kappa gene for protein phosphatase 2A B'kappa subunit, e756010926 (4)gb:OSA272423_16924304e-11Oryza sativa partial mRNA for putative B' regulatory subunit of PP2A (sircs1 gen
JMFF049L22Sequence646002122 (2)gb:OSA312313_16925161e-26Oryza sativa putative B'kappa gene for protein phosphatase 2A B'kappa subunit, e575010926 (4)
JMSF004I18Sequence166010926 (4)
JMSF004I20Sequence297001832 (7)202010926 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002K16+ TNTAGAGAGGAATAGCCAAANCCATTGGAACAAAGCGATTCTGAACCTGACACAAAAC
                      ____________________________________________________________
consensus TNTAGAGAGGAATAGCCAAANCCATTGGAACAAAGCGATTCTGAACCTGACACAAAAC
 
. : . : . : . : . : . :
rJMFF002K16+ GTGAGGAAAGTGATCACGGAGATGGACGAGGAGCTCGTGTGTGCCTGCCAAAGCAAACTC
                      ____________________________________________________________
consensus GTGAGGAAAGTGATCACGGAGATGGACGAGGAGCTCGTGTGTGCCTGCCAAAGCAAACTC
 
. : . : . : . : . : . :
rJMFF002K16+ GAGGAAGAGAAGTCGTTGTCGAATGTGGTTGCGGAGAGACGAAGGCTGACATGGGAACAC
                      ____________________________________________________________
consensus GAGGAAGAGAAGTCGTTGTCGAATGTGGTTGCGGAGAGACGAAGGCTGACATGGGAACAC
 
. : . : . : . : . : . :
rJMFF002K16+ CTCGACGTTATTGCTGCTAGCAATATTTCAGCTCTAACTAAACCCGCAAATGCAAGCTGT
rJMFF049L22+ TTTCAGCTCTAACTAAACCCGCAAATGCAAGCTGT
                      ____________________________________________________________
consensus CTCGACGTTATTGCTGCTAGCAATATTTCAGCTCTAACTAAACCCGCAAATGCAAGCTGT
 
. : . : . : . : . : . :
rJMFF002K16+ CTCGTTAGTTGTTAGATGATTGAGCATCAACGAACGCCATCCGTCTCTTGGATATACTTC
rJMFF049L22+ CTCGTTAGTTGTTAGATGATTGAGCATCAACGAACGCCATCCGTCTCTTGGATATACTTC
                      ____________________________________________________________
consensus CTCGTTAGTTGTTAGATGATTGAGCATCAACGAACGCCATCCGTCTCTTGGATATACTTC
 
. : . : . : . : . : . :
rJMFF002K16+ AATCCTTTCCTCTCGAAAGCGGGAAAAGCAGCAGATCAGTCGTCTCTTGGATACGGGGAT
rJMFF049L22+ AATCCTTTCCTCTCGAAAGCGGGAAAAGCAGCAGATCAGTCGTCTCTTGGATACGGGGAT
                      ____________________________________________________________
consensus AATCCTTTCCTCTCGAAAGCGGGAAAAGCAGCAGATCAGTCGTCTCTTGGATACGGGGAT
 
. : . : . : . : . : . :
rJMSF004I20+ CAAAGCCGTGTCAAGTGGATGAGAAAGC
rJMFF002K16+ GTACATACATATATACAATTCCCCCAGGATACCAAAGCCGTGTCAAGTGGATGAGAAAGC
rJMFF049L22+ GTACATACATATATACAATTCCCCCGGGATACCAAAGCCGTGTCAAGTGGATGAGAAAGC
                      ____________________________________________________________
consensus GTACATACATATATACAATTCCCCCGGGATACCAAAGCCGTGTCAAGTGGATGAGAAAGC
 
. : . : . : . : . : . :
rJMSF004I18+ TTAATGGAAGAAAAGTCCAAT
rJMSF004I20+ GGTTCCTCTACCTTGAATTAATGCTTACTCTTCTGGATTTTAATGGNAGAAAANTCCAAT
rJMFF002K16+ GGTTCCTCTACCTTGAATTAATGCTTACTCTTCTGGATTTTAATGGAAGAAAAGTCCAAT
rJMFF049L22+ GGTTCCTCTACCTTGAATTAATGCTTACTCTTCTGGATTTTAATGGAAGAAAAGTCCAAT
                      ____________________________________________________________
consensus GGTTCCTCTACCTTGAATTAATGCTTACTCTTCTGGATTTTAATGGAAGAAAAGTCCAAT
 
. : . : . : . : . : . :
rJMSF004I18+ GGGGTTATGCCCAGCAACATCTAGAGCTCTTACAATGGGGTTACCAAGGGATCAGGGATA
rJMSF004I20+ GGGGTNATGCCCAGCAACATNTAGAGCTCTTACAATGGGGTTACCANGGGATCAGGGANA
rJMFF002K16+ GGGGTTATGCCCAGCAACATCTAGAGCTCTTACAATGGGGTTACCAAGGGATCAGGGATA
rJMFF049L22+ GGGGTTATGCCCAGCAACATCTAGAGCTCTTACAATGGGGTTACCAAGGGATCAGGGATA
                      ____________________________________________________________
consensus GGGGTTATGCCCAGCAACATCTAGAGCTCTTACAATGGGGTTACCAAGGGATCAGGGATA
 
. : . : . : . : . : . :
rJMSF004I18+ TGGAGGTCACCAGATTATGTTATTATAAGTATGTTTTAGCCATTTGGTTTGGGAGATTAA
rJMSF004I20+ TNGAGGTCACCAGNTTANGTTATTATAAGTATGTNTTAGCCATTTGGTNTGGGA
rJMFF002K16+ TGGAGGTCACCAGATTATGTTATTATAAGTATGTTTTAGCCATTTGGTTTGGGAGATTAA
rJMFF049L22+ TGGAGGTCACCAGATTATGTTATTATAAGTATGTTTTAGCCATTTGGTTTGGGAGATTAA
                      ____________________________________________________________
consensus TGGAGGTCACCAGATTATGTTATTATAAGTATGTTTTAGCCATTTGGTTTGGGAGATTAA
 
. : . : . : . : . : . :
rJMSF004I18+ TAGCTAATGCACCATGAATGTTCAT
rJMFF002K16+ TAGCTAATGCACCATGAATGTTCATCATATTTGTCTCTTTTCTTTTCATCTTTTTCTTAT
rJMFF049L22+ TAGCTAATGCACCATGAATGTTCATCATATTTGTCTCTTTTCTTTTCATCTTTTTCTTAT
                      ____________________________________________________________
consensus TAGCTAATGCACCATGAATGTTCATCATATTTGTCTCTTTTCTTTTCATCTTTTTCTTAT
 
. : . : . : . : . : . :
rJMFF002K16+ ATTACATAGTATGAGGTGGAAAAGCTGTATGTGTTGATTGTTAGCAAGCAAGCATGCACT
rJMFF049L22+ ATTACATAGTATGAGGTGGAAAAGCTGTATGTGTTGATTGTTAGCAAGCAAGCATGCACT
                      ____________________________________________________________
consensus ATTACATAGTATGAGGTGGAAAAGCTGTATGTGTTGATTGTTAGCAAGCAAGCATGCACT
 
. : . : . : . : . : . :
rJMFF002K16+ GTAAGTAAGTCTTTGTATGAGTTGGGAGATTAAGTAGC
rJMFF049L22+ GTAAGTAAGTCTTTGTATGAGTTGGGAGATTAAGTAGCTGCTAGCTAGTTCTTTGCATCG
                      ____________________________________________________________
consensus GTAAGTAAGTCTTTGTATGAGTTGGGAGATTAAGTAGCTGCTAGCTAGTTCTTTGCATCG