Previous Contig 010924:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I08Sequence565004786 (9)pir|C96732|C967321e-10hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946732010924 (10)pir|C96732|C967323e-18hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMFF016K24Sequence524004786 (9)pir|C96732|C967321e-10hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946780010924 (10)gb:AP002538_18225091e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF021C12Sequence473004786 (9)pir|C96732|C967329e-11hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946695010924 (10)pir|A86366|A863666e-12T26J12.6 protein - Arabidopsis thaliana>gb:AE005172_891266 Arabidopsis thaliana
JMFF038D11Sequence608010924 (10)pir|C96732|C967323e-53hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946770010924 (10)gb:AP002538_18225091e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF049L17Sequence634004786 (9)pir|C96732|C967323e-18hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946599010924 (10)gb:AP002538_18225095e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF006B18Sequence248018454497010924 (10)gb:AP002538_18225097e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF007A12Sequence243004786 (9)755010924 (10)pir|C96732|C967328e-18hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMSF031L08Sequence676004786 (9)pir|C96732|C967322e-60hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946706010924 (10)pir|C96732|C967324e-17hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMSF050J24Sequence641004786 (9)pir|C96732|C967323e-22hypothetical protein F15H11.2 [imported] - Arabidopsis thaliana>gb:AE005173_8946719010924 (10)gb:AP002538_18225091e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038D11- GTGCCACCATCCGCACTTGATTTGCTGTTACGAGTGACGTTTCCTGCTT
                      ____________________________________________________________
consensus GTGCCACCATCCGCACTTGATTTGCTGTTACGAGTGACGTTTCCTGCTT
 
. : . : . : . : . : . :
JMFF038D11- CTTCAGCACGAGTTAAGGCTACCGAAAGGTTTGAGAAAATATATCCCACTCTCAAAGAGA
                      ____________________________________________________________
consensus CTTCAGCACGAGTTAAGGCTACCGAAAGGTTTGAGAAAATATATCCCACTCTCAAAGAGA
 
. : . : . : . : . : . :
JMFF038D11- TTGCTCTTGCTGGTTCTCCTGGCAGCAAAGCAATGAAGCAAGCGTCGCTTCAGATCTTTG
                      ____________________________________________________________
consensus TTGCTCTTGCTGGTTCTCCTGGCAGCAAAGCAATGAAGCAAGCGTCGCTTCAGATCTTTG
 
. : . : . : . : . : . :
JMFF038D11- CATTTGCTACTAAGGCTGCTGGGGAAGGTATTTCCGAACTATCTAAGGAAGGGACGAGCA
rJMSF050J24+ ACGAGCA
rJMFF038D11+ ACGAGCA
                      ____________________________________________________________
consensus CATTTGCTACTAAGGCTGCTGGGGAAGGTATTTCCGAACTATCTAAGGAAGGGACGAGCA
 
. : . : . : . : . : . :
JMFF038D11- TATTTATATGGTGTTTGACCCAAAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
rJMSF050J24+ TATTTATATGGTGTTTGACCCAAAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
rJMFF038D11+ TATTTATATGGTGTTTGACCCAAAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
rJMFF002I08+ TTGACCCAAAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
rJMSF031L08+ AAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
rJMFF016K24+ TTTGACCCAAAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
rJMSF007A12+ TTGACCCAAAATGCTGAGTGTTTCCAGCAGTGGGATAAGATATATC
                      ____________________________________________________________
consensus TATTTATATGGTGTTTGACCCAAAATGCTGAGTGTTTCAAGCAGTGGGATAAGATATATC
 
. : . : . : . : . : . :
JMFF038D11- TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMSF050J24+ TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMFF038D11+ TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMFF002I08+ TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMSF031L08+ TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMFF021C12+ CATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMFF016K24+ TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
rJMSF007A12+ TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
                      ____________________________________________________________
consensus TGGATAACATAGCAGCGAGTGTTGCTGCCTTGAGAAAGCTCAAAGAAGAGTGGAGAGTGT
 
. : . : . : . : . : . :
JMFF038D11- TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMSF050J24+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMFF038D11+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMFF002I08+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMSF031L08+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMFF021C12+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMFF016K24+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMSF007A12+ TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
rJMFF049L17+ CA
                      ____________________________________________________________
consensus TGTCTGCAAATCAATCTTCGCTTGTTGTTGCCAGAGAAACTCTCAAGGGTTTCAGGAACA
 
. : . : . : . : . : . :
JMFF038D11- AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMSF050J24+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMFF038D11+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMFF002I08+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMSF031L08+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMFF021C12+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMSF006B18+ CTTAAAGACG
rJMFF016K24+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMSF007A12+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
rJMFF049L17+ AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
                      ____________________________________________________________
consensus AGAATGAGGAAGCATTAAGTGACGGAGTCGATGCTAAACATCAATCACTGCTTAAAGACG
 
. : . : . : . : . : . :
JMFF038D11- CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMSF050J24+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMFF038D11+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMFF002I08+ CAGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMSF031L08+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMFF021C12+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMSF006B18+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMFF016K24+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMSF007A12+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
rJMFF049L17+ CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
                      ____________________________________________________________
consensus CTGACAAGTACTGCAAGGTTTTGCTGGGAAGGCTGTCTCGTGGACACGCATGCTTGAAGA
 
. : . : . : . : . : . :
JMFF038D11- GTTTGGCCGTCATCGTGGTCTTACTGGGCGTGGGGAGTAGCTGTTACTAACCCCGATATA
rJMSF050J24+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMFF038D11+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMFF002I08+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMSF031L08+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMFF021C12+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMSF006B18+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMFF016K24+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMSF007A12+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
rJMFF049L17+ GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
                      ____________________________________________________________
consensus GTTTGGCCGTCATCGTGGTCTTACTGGGCGT-GGGAGTAGCTGTTACTAACCCCGATATA
 
. : . : . : . : . : . :
JMFF038D11- CAGTCCGTGGGACTGGGAC
rJMSF050J24+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMFF038D11+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMFF002I08+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMSF031L08+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMFF021C12+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMSF006B18+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMFF016K24+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMSF007A12+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
rJMFF049L17+ CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
                      ____________________________________________________________
consensus CAGT-CGTGGGACTGGGACAAGTTGAACCACAAGTTGATGGTTCTGTTCAACGCCCCCCT
 
. : . : . : . : . : . :
rJMSF050J24+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMFF038D11+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACNGAGGATACGAGGTATTTATTTC
rJMFF002I08+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMSF031L08+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMFF021C12+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMSF006B18+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMFF016K24+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMSF007A12+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
rJMFF049L17+ CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
                      ____________________________________________________________
consensus CCGATCTTAGTAGCTTTCTTCGCCCGACGAGTGAGACAGAGGATACGAGGTATTTATTTC
 
. : . : . : . : . : . :
rJMSF050J24+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMFF038D11+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMFF002I08+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMSF031L08+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMFF021C12+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMSF006B18+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMFF016K24+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMSF007A12+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
rJMFF049L17+ AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
                      ____________________________________________________________
consensus AACGAAAAAGCTAATAAAATTTGTCCAGAATAAAAAGAAAGGACAAAAATATGTATGGGG
 
. : . : . : . : . : . :
rJMSF050J24+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMFF038D11+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMFF002I08+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMSF031L08+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMFF021C12+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMSF006B18+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMFF016K24+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMSF007A12+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
rJMFF049L17+ TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
                      ____________________________________________________________
consensus TAGTTTCAGGGTCTCGTCGAGGTGAGTTGTGAGGTATGACTGGAATTTTCGCGAGGAAAG
 
. : . : . : . : . : . :
rJMSF050J24+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMFF038D11+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMFF002I08+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGGCTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMSF031L08+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMFF021C12+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMSF006B18+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMFF016K24+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMSF007A12+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
rJMFF049L17+ GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
                      ____________________________________________________________
consensus GATGAAATAGGTAAAAAAAAATGGAGAGGGGACTAAATGGCTCTCTCTTTTTAGCTCTAA
 
. : . : . : . : . : . :
rJMSF050J24+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTT
rJMFF038D11+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
rJMFF002I08+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
rJMSF031L08+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
rJMFF021C12+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
rJMSF006B18+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
rJMFF016K24+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
rJMSF007A12+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCCCTAACAACATCTTTGTTTCTG
rJMFF049L17+ GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
                      ____________________________________________________________
consensus GTGAAGTTTGATCTCAAGTATTTAGTTATTGGCTCAGCTCTAACAACATCTTTGTTTCTG
 
. : . : . : . : . : . :
rJMFF038D11+ GCAAAAAACTGTCTTA-CAGAGAGAAATTGTAC-TCAAAAGAAGGAT
rJMFF002I08+ GCAAAAAACTGTCTTA-CAGAGAGAAATT
rJMSF031L08+ GCAAAAAACT
rJMFF021C12+ GCAAAAAACTGTCTTA-CAGAGAGAAATTGTAC-TCAAAAGAAGGA
rJMSF006B18+ GCAAAAAAC
rJMFF016K24+ GCAAAAAACTGTCTTA-CAGAGAGAAATTGTAC-TCAAAAGAAGGAT
rJMSF007A12+ GCAAAAAACTGTCTTACCAGAGAGAAATTGTACTTCAAAAGAAGGAT
rJMFF049L17+ GCAAAAAACTGTCTTA-CAGAGAGAAATTGTACTTCAAAAGAAGGATTTTGTTATGTTCC
                      ____________________________________________________________
consensus GCAAAAAACTGTCTTA-CAGAGAGAAATTGTAC-TCAAAAGAAGGATTTTGTTATGTTCC