Previous Contig 010910:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013I02Sequence661010910 (7)gb:AY085581_15706507e-48Arabidopsis thaliana clone 15825 mRNA, complete sequence.
JMFF020O19Sequence540001051 (7)gb:AJ622897_18123904e-53Brassica napus mRNA for amino acid permease (aap2 gene).730010910 (7)gb:AJ843989_18146815e-85Plantago major partial mRNA for amino acid permease (aap3 gene).
JMFF029J15Sequence484001051 (7)gb:AJ622897_18123905e-44Brassica napus mRNA for amino acid permease (aap2 gene).783010910 (7)gb:AY085581_15706503e-79Arabidopsis thaliana clone 15825 mRNA, complete sequence.
JMFF049H23Sequence645001051 (7)gb:AJ622897_18123903e-73Brassica napus mRNA for amino acid permease (aap2 gene).511010910 (7)gb:AJ843989_18146818e-39Plantago major partial mRNA for amino acid permease (aap3 gene).
JMFS142G05Sequence626010910 (7)gb:AF080543_17664461e-99Nepenthes alata amino acid transporter (AAP2) mRNA, partial cds.
JMSF032O23Sequence694001051 (7)gb:AJ622897_18123901e-81Brassica napus mRNA for amino acid permease (aap2 gene).606010910 (7)gb:AJ843989_18146817e-71Plantago major partial mRNA for amino acid permease (aap3 gene).
JMSF039E17Sequence655001051 (7)gb:AJ622897_18123903e-76Brassica napus mRNA for amino acid permease (aap2 gene).847010910 (7)gb:AF013278_17612685e-74Lycopersicon esculentum amino acid transporter (LeAAP3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS142G05- TACATGATTGCTTTTGGAATTATAGAAATTATTCTATCTCAAATCCCGGAT
                      ____________________________________________________________
consensus TACATGATTGCTTTTGGAATTATAGAAATTATTCTATCTCAAATCCCGGAT
 
. : . : . : . : . : . :
JMFS142G05- TTTGATCAAATATGGTGGCTCTCAATAGTTGCTGCTGTTATGTCCTTTACCTACTCTGGA
                      ____________________________________________________________
consensus TTTGATCAAATATGGTGGCTCTCAATAGTTGCTGCTGTTATGTCCTTTACCTACTCTGGA
 
. : . : . : . : . : . :
JMFS142G05- ATTGGATTGGGGCTTGGAATTGCACAAGTTGTTGCTAACGGGGCTTTCAAGGGCAGCCTC
                      ____________________________________________________________
consensus ATTGGATTGGGGCTTGGAATTGCACAAGTTGTTGCTAACGGGGCTTTCAAGGGCAGCCTC
 
. : . : . : . : . : . :
JMFS142G05- ACTGGCATTAGCATTGGAACTGTTACTGAAACCCAAAAAATATGGAGGAGTTTTCAAGCT
                      ____________________________________________________________
consensus ACTGGCATTAGCATTGGAACTGTTACTGAAACCCAAAAAATATGGAGGAGTTTTCAAGCT
 
. : . : . : . : . : . :
JMFS142G05- CTTGGAGACATTGCTTTTGCCTATTCATATTCCATCATTCTTATTGAAATTCAGGACACG
rJMSF039E17+ TTCAGGACACG
                      ____________________________________________________________
consensus CTTGGAGACATTGCTTTTGCCTATTCATATTCCATCATTCTTATTGAAATTCAGGACACG
 
. : . : . : . : . : . :
JMFS142G05- GTGAAATCTCCGCCGTCAGAATCAAAGACGATGAGGAAAGCTAGCCTGTTCAGCACTATA
rJMFF020O19+ TGTTCAGCACTATA
rJMFF029J15+ CGTCAGAATCAAAGACGATGAGGAAAGCTAGCCTGTTCAGCACTATA
rJMSF039E17+ GTGAAATCTCCGCCGTCAGAATCAAAGACGATGAGGAAAGCTAGCCTGTTCAGCACTATA
                      ____________________________________________________________
consensus GTGAAATCTCCGCCGTCAGAATCAAAGACGATGAGGAAAGCTAGCCTGTTCAGCACTATA
 
. : . : . : . : . : . :
JMFS142G05- GTGACTACAACTTTCTACATGCTATGCGGGTGCATGGGTTACGCAGCATTCGGGGATGAT
rJMFF020O19+ GTGACTACAACTTTNTACATGCTATGCGGGTGCATGGGTTACGCAGCATTCGGGGATGAT
rJMFF029J15+ GTGACTACAACTTTCTACATGCTATGCGGGTGCATGGGTTACGCAGCATTCGGGGATGAT
rJMSF039E17+ GTGACTACAACTTTCTACATGCTATGCGGGTGCATGGGTTACGCAGCATTCGGGGATGAT
                      ____________________________________________________________
consensus GTGACTACAACTTTCTACATGCTATGCGGGTGCATGGGTTACGCAGCATTCGGGGATGAT
 
. : . : . : . : . : . :
JMFS142G05- GCGCCCGGGAATCTCTTAACCGGGTTCGGGTTCTACAACCC-TTTTTGGCTCCTGGATAT
rJMSF032O23+ GTTCGGGTTCTACAACCC-TTTTTGGCTCCTGGATAT
rJMFF020O19+ GCGCCCGGGAATCTCTTAACCGGGTTCGGGTTCTACAACCC-TTTTTGGCTCCTGGATAT
rJMFF029J15+ GCGCCCGGGAATCTCTTAACCGGGTTCGGGTTCTACAACCC-TTTTTGGCTCCTGGATAT
rJMFF013I02+ CCTGGATAT
rJMSF039E17+ GCGCCCGGGAATCTCTTAACCGGGTTCGGGTTCTACAACCCTTTTTTGGCTCCTGGATAT
                      ____________________________________________________________
consensus GCGCCCGGGAATCTCTTAACCGGGTTCGGGTTCTACAACCC-TTTTTGGCTCCTGGATAT
 
. : . : . : . : . : . :
JMFS142G05- CGCCAACGCCGCCATCGTCATCCACCTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
rJMSF032O23+ CGCCAACGCCGCCATCGTCATCCACCTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
rJMFF020O19+ CGCCAACGCCGCCATCGTCATCCACCTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
rJMFF029J15+ CGCCAACGCCGCCATCGTCATCCACCTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
rJMFF013I02+ CGCCAACGCCGCCATCGTCATCCACNTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
rJMSF039E17+ CGCCAACGCCGCCATCGTCATCCACCTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
                      ____________________________________________________________
consensus CGCCAACGCCGCCATCGTCATCCACCTTGTGGGAGCCTACCAAGTGTACTGCCAGCCGCT
 
. : . : . : . : . : . :
JMFS142G05- GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACAGCGAGAT-CATCACCA
rJMSF032O23+ GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACGGCGAGAT-CATCACCA
rJMFF020O19+ GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACAGCGAGAT-CATCACCA
rJMFF029J15+ GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACAGCGAGATCCATCACCA
rJMFF013I02+ GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACAGCGAGATCCATCACCA
rJMSF039E17+ GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACAGCGAGAT-CATCACCA
                      ____________________________________________________________
consensus GTTTGCATTCATCGAGAAATGGGTCGGGGCGAAATGGCCCGACAGCGAGAT-CATCACCA
 
. : . : . : . : . : . :
JMFS142G05- AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCC
rJMSF032O23+ AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCCGTATAAACTGAATACTTTCCGGT
rJMFF020O19+ AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCCGTATAAACTGAATACTTTCCGGT
rJMFF029J15+ AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCCGTATAAACTGAATACTTTCCGGT
rJMFF013I02+ AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCCGTATAAACTGAATACTTTCCGGT
rJMSF039E17+ AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCCGTATAAACTGAATACTTTCCGGT
rJMFF049H23+ CGGGTACCCGTATAAACTGAATACTTTCCGGT
                      ____________________________________________________________
consensus AGGAAATCAACCTGAAAATCCCCGGGTTCGGGTACCCGTATAAACTGAATACTTTCCGGT
 
. : . : . : . : . : . :
rJMSF032O23+ TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
rJMFF020O19+ TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
rJMFF029J15+ TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
rJMFF013I02+ TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
rJMSF039E17+ TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
rJMFF049H23+ TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
                      ____________________________________________________________
consensus TGCTGTGGCGCACGGCGTTCGTGCTCTTAACCACCGTCATATCCATGTTGCTGCCTTTCT
 
. : . : . : . : . : . :
rJMSF032O23+ TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
rJMFF020O19+ TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
rJMFF029J15+ TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
rJMFF013I02+ TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
rJMSF039E17+ TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
rJMFF049H23+ TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
                      ____________________________________________________________
consensus TCAACGACGTCGTTGGGATTCTCGGGGCGTTCGGGTTCTGGCCGTTGACCGTGTATTTTC
 
. : . : . : . : . : . :
rJMSF032O23+ CGGTAAGGATGTACATTTCACAGAAG-AAAATACCCAAGTGGAGCACCCGGTGGATTTGC
rJMFF020O19+ CGGTAAGGATGTACATTTCACAGAAG-AAAATACCCAAGTGGAGCACCCGGTGGATTTGC
rJMFF029J15+ CGGTAAGGATGTACATTTCACAGAAG-AAAATACCCAAGTGGAGCACCCGGTGGATTTGC
rJMFF013I02+ CGGTAAGGATGTACATTTCACAGAAGAAAAATACCCAAGTGGAGCACCCGGTGGATTTGC
rJMSF039E17+ CGGTAAGGATGTACATTTCACAGAAG-AAAATACCCAAGTGGAGCACCCGGTGGATTTGC
rJMFF049H23+ CGGTAAGGATGTACATTTCACAGAAG-GAAATACCCAAGTGGAGCACCCGGTGGATTTGC
                      ____________________________________________________________
consensus CGGTAAGGATGTACATTTCACAGAAG-AAAATACCCAAGTGGAGCACCCGGTGGATTTGC
 
. : . : . : . : . : . :
rJMSF032O23+ CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
rJMFF020O19+ CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
rJMFF029J15+ CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
rJMFF013I02+ CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
rJMSF039E17+ CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
rJMFF049H23+ CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
                      ____________________________________________________________
consensus CTCCAAATGCTGAGCGGCGCTTGCTTGGCGGTGTCGCTCGCGGCGGCCGCCGGTTCGTTC
 
. : . : . : . : . : . :
rJMSF032O23+ GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
rJMFF020O19+ GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
rJMFF029J15+ GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
rJMFF013I02+ GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
rJMSF039E17+ GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
rJMFF049H23+ GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
                      ____________________________________________________________
consensus GCCGGTGTGGTTCTTGATCTTAAGCTTTACAGACCATTCAAGACTAGCTACTAAAGTGAA
 
. : . : . : . : . : . :
rJMSF032O23+ GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
rJMFF020O19+ GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
rJMFF029J15+ GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
rJMFF013I02+ GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
rJMSF039E17+ GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
rJMFF049H23+ GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
                      ____________________________________________________________
consensus GTATTTAGTCATTGCGCGCCATGCATTATATTGCATGAACAAGCTAAGGATCATGTTCAT
 
. : . : . : . : . : . :
rJMSF032O23+ GTATGTAATTAATTCCAATAACAAAATTAAAG
rJMFF020O19+ GTATGTAATTAATTCCAATAACAAAATTAAAGCATGTAATGGGGGCTAAAGTGTCAATT
rJMFF029J15+ GTATGTAATTAATTCCAATAACAAAATTAAAGCATGTAATGGGGGCTAAAGTGTCAATTT
rJMFF013I02+ GTATGTAATTAATTCCAATAACAAAATTAAAGCATGTAATGGGGGCTAAAGTGTCAATTT
rJMSF039E17+ GTATGTAATTAATTCCAATAACAAAATTAAAGCATGTAATGGGGGCTAAAGTGTCAATTT
rJMFF049H23+ GTATGTAATTAATTCCAATAACAAAATTAAAGCATGTAATGGGGGCTAAAGTGTCAATTT
                      ____________________________________________________________
consensus GTATGTAATTAATTCCAATAACAAAATTAAAGCATGTAATGGGGGCTAAAGTGTCAATTT
 
. : . : . : . : . : . :
rJMFF029J15+ ATGAAG-TTGAGCAGCCCA
rJMFF013I02+ ATGAAGTTTGAGCAGCCCATTTAATAAATAAAAAAGTCTCGTGTCAT
rJMSF039E17+ ATGAAGTTTGAGCAGCCCATTTAATAAATAAAAAAGTCTCGTGTCAT
rJMFF049H23+ ATGAAGTTTGAGCAGCCCATTTAATAAATAAAAAAGTCTCGTGTCATTACTCATGTATTG
                      ____________________________________________________________
consensus ATGAAGTTTGAGCAGCCCATTTAATAAATAAAAAAGTCTCGTGTCATTACTCATGTATTG