Previous Contig 010905:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039I21Sequence268005354 (5)666010905 (3)sp|P11043|AROA_PETHY2e-793-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19
JMFF049G07Sequence425005354 (5)sp|P11043|AROA_PETHY2e-353-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19318010905 (3)gb:AY545667_16129457e-20Conyza canadensis 5-enol-pyruvylshikimate-phosphate synthase (EPSPS2) gene, comp
JMSF032M23Sequence651005354 (5)sp|P11043|AROA_PETHY1e-643-phosphoshikimate 1-carboxyvinyltransferase, chloroplast precursor (EC 2.5.1.19584010905 (3)gb:AY545666_16129442e-68Conyza canadensis 5-enol-pyruvylshikimate-phosphate synthase (EPSPS1) gene, comp

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039I21+ CTCGAGAAGATGGGAGCCGAAGTTTTGTGGACAGAGAACAGTG
                      ____________________________________________________________
consensus CTCGAGAAGATGGGAGCCGAAGTTTTGTGGACAGAGAACAGTG
 
. : . : . : . : . : . :
rJMSF032M23+ CCTTCGGGAAGGAAACACTTACGTGCCATTGACG
rJMFF039I21+ TTNCCGTGAAAGGACCACCACGGGCACCTTCGGGAAGGAAACACTTACGTGCCATNGACG
                      ____________________________________________________________
consensus TTNCCGTGAAAGGACCACCACGGGCACCTTCGGGAAGGAAACACTTACGTGCCATTGACG
 
. : . : . : . : . : . :
rJMSF032M23+ TGAACATGAATAAAATGCCCGATGTTGCCATGACTCTTGCTGTAGTTGCGCTATTTGCTG
rJMFF039I21+ TGAACATGAATAAAATGCCCGATGTTGCCATGACTCTTGCTGTAGTTGCGCTATTTGCTG
                      ____________________________________________________________
consensus TGAACATGAATAAAATGCCCGATGTTGCCATGACTCTTGCTGTAGTTGCGCTATTTGCTG
 
. : . : . : . : . : . :
rJMSF032M23+ ATGGCCCGACAGCCATAAGAGACGTTGCTAGCTGGAGAGTTAAGGAAACCGAACGGATGA
rJMFF039I21+ ATGGCCCGACAGCCATAAGAGACGTTGCTAGCTGGAGAGTTAAGGAAACCGAACGGATGA
                      ____________________________________________________________
consensus ATGGCCCGACAGCCATAAGAGACGTTGCTAGCTGGAGAGTTAAGGAAACCGAACGGATGA
 
. : . : . : . : . : . :
rJMSF032M23+ TTGCTATATGCACAGAACTTAGAAAGCTGGGAGCGACGGTCGAGGAAGGGCCAGACTACT
rJMFF039I21+ TTGCTATATGCACAGAACTTAGAAAGCTGGGAGCGACGGTCGAGGAAGGGCCAGACTACT
                      ____________________________________________________________
consensus TTGCTATATGCACAGAACTTAGAAAGCTGGGAGCGACGGTCGAGGAAGGGCCAGACTACT
 
. : . : . : . : . : . :
rJMSF032M23+ GTATAATCACTCCACCCGAGAAACTAAACGTGACGGAAATCGACACATACGACGATCACA
rJMFF039I21+ GTATAATCACTCCACCCGAGAAACTAAACGTGACGGAAATCGACACATACGACGATCACA
rJMFF049G07+ ACACATACGACGATCACA
                      ____________________________________________________________
consensus GTATAATCACTCCACCCGAGAAACTAAACGTGACGGAAATCGACACATACGACGATCACA
 
. : . : . : . : . : . :
rJMSF032M23+ GAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCCGAGGTACCAGTCACCATTAAAGATC
rJMFF039I21+ GAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCCGAGGTACCAGTCACCATTAAAGATC
rJMFF049G07+ GAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCCGAGGTACCAGTCACCATTAAAGATC
                      ____________________________________________________________
consensus GAATGGCCATGGCGTTTTCTCTTGCTGCTTGTGCCGAGGTACCAGTCACCATTAAAGATC
 
. : . : . : . : . : . :
rJMSF032M23+ CTGGCTGTACTCGCAAGACTTTCCCAGATTATTTTGAGGTTCTTCAGAGGTTTTCTAAGC
rJMFF039I21+ CTGGCTGTACTCGCAAGACTTTCCCAGATTATTTTGAGGTTCTTCAGAGGTTTTCTAAGC
rJMFF049G07+ CTGGCTGTACCCGCAAGACTTTCCCAGATTATTTTGAGGTTCTTCAGAGGTTTTCTAAGC
                      ____________________________________________________________
consensus CTGGCTGTACTCGCAAGACTTTCCCAGATTATTTTGAGGTTCTTCAGAGGTTTTCTAAGC
 
. : . : . : . : . : . :
rJMSF032M23+ ATTAAAAAGGTTTCCTTTACATCCATTTTGGAAGGTAGAGATCTGTGTTAGTTGAAAGAG
rJMFF039I21+ ATTAAAAAGGTTTCCTTTACATCCATTTTGGAAGGTAGAGATCTGTGTTAGTTGAAAGAG
rJMFF049G07+ ATTAAAAAGGTTTCCTTTACATCCATTTTGGAAGGTAGAGATCTGTGTTAGTTGAAAGAG
                      ____________________________________________________________
consensus ATTAAAAAGGTTTCCTTTACATCCATTTTGGAAGGTAGAGATCTGTGTTAGTTGAAAGAG
 
. : . : . : . : . : . :
rJMSF032M23+ CTACTCCCAACTACCATGTTCCTCTTAGTTAAGGTT
rJMFF039I21+ CTACTCCCAACTACCATGTTCCTCTTAGTTAAGGTT
rJMFF049G07+ CTACTCCCAACTACCATGTTCCTCTTAGTTAAGGTTGAACTGGTTTTCATTTGCAAATAT
                      ____________________________________________________________
consensus CTACTCCCAACTACCATGTTCCTCTTAGTTAAGGTTGAACTGGTTTTCATTTGCAAATAT
 
. : . : . : . : . : . :
rJMFF049G07+ AAACACGTTAAACATCAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAACACGTTAAACATCAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG