Previous Contig 010903:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007M06Sequence648010903 (4)gb:AY088391_15734111e-51Arabidopsis thaliana clone 6411 mRNA, complete sequence.>gb:BT004185_1637282 Ara760010903 (4)gb:AY088391_15734113e-58Arabidopsis thaliana clone 6411 mRNA, complete sequence.>gb:BT004185_1637282 Ara
JMFF049G02Sequence636010903 (4)gb:AY088391_15734119e-32Arabidopsis thaliana clone 6411 mRNA, complete sequence.>gb:BT004185_1637282 Ara608010903 (4)gb:AY088391_15734111e-38Arabidopsis thaliana clone 6411 mRNA, complete sequence.>gb:BT004185_1637282 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049G02- ACGTACAACTGCAAAACGCTCTCTTTATGACACAACCCACCCTATTTCTTT
                      ____________________________________________________________
consensus ACGTACAACTGCAAAACGCTCTCTTTATGACACAACCCACCCTATTTCTTT
 
. : . : . : . : . : . :
JMFF049G02- AGACCACTCTTTTCATTTCATTTCATTTTAATTTCCACTCTGATTTTTTTTTAGTTCAAA
JMFF007M06- AAA
                      ____________________________________________________________
consensus AGACCACTCTTTTCATTTCATTTCATTTTAATTTCCACTCTGATTTTTTTTTAGTTCAAA
 
. : . : . : . : . : . :
JMFF049G02- ATCAGTTCTTGGACTCTGATCTGCTTTCAGTTCTTGGACTCTTTCTTCTTCTGGGTTTTC
JMFF007M06- ATCAGTTCTTGGACTCTGATCTGCTTTCAGTTCTTGGACTCTTTCTTCTTCTGGGTTTTC
                      ____________________________________________________________
consensus ATCAGTTCTTGGACTCTGATCTGCTTTCAGTTCTTGGACTCTTTCTTCTTCTGGGTTTTC
 
. : . : . : . : . : . :
JMFF049G02- TTCAAAATCCCTTCTTGGCTGGCTTCTTTTCTACATCCGGATTGAGTATTGTGAGCTGAA
JMFF007M06- TTCAAAATCCCTTCTTGGCTGGCTTCTTTTCTACATCCGGATTGAGTATTGTGAGCTGAA
                      ____________________________________________________________
consensus TTCAAAATCCCTTCTTGGCTGGCTTCTTTTCTACATCCGGATTGAGTATTGTGAGCTGAA
 
. : . : . : . : . : . :
JMFF049G02- CCAGATGGGTAACGTTGTTAATACTCTGCATTTTGTGCTCGGGATCTTTGGAAATGTCAC
JMFF007M06- CCAGATGGGTAACGTTGTTAATACTCTGCATTTTGTGCTCGGGGTCTTTGGAAATGTCAC
                      ____________________________________________________________
consensus CCAGATGGGTAACGTTGTTAATACTCTGCATTTTGTGCTCGGGGTCTTTGGAAATGTCAC
 
. : . : . : . : . : . :
JMFF049G02- TGCTTTGTTCCTCTTCCTGGCACCATTGATTACATTTAAGAGGATCGTCGCAAAAAAATC
JMFF007M06- TGCTTTGTTCCTCTTCCTGGCACCATTGATTACATTTAAGAGGATCGTCGCAAAAAAATC
                      ____________________________________________________________
consensus TGCTTTGTTCCTCTTCCTGGCACCATTGATTACATTTAAGAGGATCGTCGCAAAAAAATC
 
. : . : . : . : . : . :
JMFF049G02- GACTGAACAGTTTTCTGGCTTGCCCTATGTCATGACCATGCTCAACTGTTTGCTTTCTGC
JMFF007M06- GACTGAACAGTTTTCTGGCTTGCCCTATGTCATGACCATGCTCAACTGTTTGCTTTCTGC
rJMFF007M06+ CTGGCTTGCCCTATGTCATGACCATGCTCAACTGTTTGCTTTCTGC
                      ____________________________________________________________
consensus GACTGAACAGTTTTCTGGCTTGCCCTATGTCATGACCATGCTCAACTGTTTGCTTTCTGC
 
. : . : . : . : . : . :
JMFF049G02- TTGGTATGGTATGCCTTTTGTGTCACCTAACAACTTGCTTGTGTCAACAATCAATGGGAC
JMFF007M06- TTGGTATGGTATGCCTTTTGTGTCACCTAACAACTTGCTTGTGTCAACAATCAATGGGAC
rJMFF007M06+ TTGGTATGGTATGCCTTTTGTGTCACCTAACAACTTGCTTGTGTCAACAATCAATGGGAC
                      ____________________________________________________________
consensus TTGGTATGGTATGCCTTTTGTGTCACCTAACAACTTGCTTGTGTCAACAATCAATGGGAC
 
. : . : . : . : . : . :
JMFF049G02- TGGTGCTGTAATTGAGTTCATTTATGTGTTGGTATTCCTTATATTTGCACCAAAGAAGGC
JMFF007M06- TGGTGCTGTAATTGAGTTCATTTATGTGTTGGTATTCCTTATATTTGCACCAAAGAAGGC
rJMFF007M06+ TGGTGCTGTAATTGAGTTCATTTATGTGTTGGTATTCCTTATATTTGCACCAAAGAAGGC
rJMFF049G02+ AAGAAGGC
                      ____________________________________________________________
consensus TGGTGCTGTAATTGAGTTCATTTATGTGTTGGTATTCCTTATATTTGCACCAAAGAAGGC
 
. : . : . : . : . : . :
JMFF049G02- AAAGAAGAAGATAGGAGCAATCTTCATCTTATCCCTTCTTATATTTGCTGCTGTCGCTTT
JMFF007M06- AAAGAAGAAGATAGGAGCAATCTTCATCTTATCCCTTCTTATATTTGCTGCTGTCGCTTT
rJMFF007M06+ AAAGAAGAAGATAGGAGCAATCTTCATCTTATCCCTTCTTATATTTGCTGCTGTCGCTTT
rJMFF049G02+ AAAGAAGAAGATAGGAGCAATCTTCATCTTATCCCTTCTTATATTTGCTGCTGTCGCTTT
                      ____________________________________________________________
consensus AAAGAAGAAGATAGGAGCAATCTTCATCTTATCCCTTCTTATATTTGCTGCTGTCGCTTT
 
. : . : . : . : . : . :
JMFF049G02- GGTTTCCTTGCTTGCATTGCATGGAAAAACCAGGAAGCTTTTCTG
JMFF007M06- GGTTTCCTTGCTTGCATTGCATGGAAAAACCAGGAAGCTTTTCTGTGGCGTTGCGGCAAC
rJMFF007M06+ GGTTTCCTTGCTTGCATTGCATGGAAAAACCAGGAAGCTTTTCTGTGGCGTTGCGGCAAC
rJMFF049G02+ GGTTTCCTTGCTTGCATTGCATGGAAAAACCAGGAAGCTTTTCTGTGGCGTTGCGGCAAC
                      ____________________________________________________________
consensus GGTTTCCTTGCTTGCATTGCATGGAAAAACCAGGAAGCTTTTCTGTGGCGTTGCGGCAAC
 
. : . : . : . : . : . :
JMFF007M06- AATCCTCTCCATTATTATGTATGGCTCACCTCTGTCAATCATAAGGCTAGTGATTAAAAC
rJMFF007M06+ AATCCTCTCCATTATTATGTATGGCTCACCTCTGTCAATCATAAGGCTAGTGATTAAAAC
rJMFF049G02+ AATCCTCTCCATTATTATGTATGGCTCACCTCTGTCAATCATAAGGCTAGTGATTAAAAC
                      ____________________________________________________________
consensus AATCCTCTCCATTATTATGTATGGCTCACCTCTGTCAATCATAAGGCTAGTGATTAAAAC
 
. : . : . : . : . : . :
JMFF007M06- AAAGAGTGTGGAGTTCATGCCATTCTTCTTGTCTCTGTTTGTGT
rJMFF007M06+ AAAGAGTGTGGAGTTCATGCCATTCTTCTTGTCTCTGTTTGTGTTCTTGTGTGGCACTTC
rJMFF049G02+ AAAGAGTGTGGAGTTCATGCCATTCTTCTTGTCTCTGTTTGTGTTCTTGTGTGGCACTTC
                      ____________________________________________________________
consensus AAAGAGTGTGGAGTTCATGCCATTCTTCTTGTCTCTGTTTGTGTTCTTGTGTGGCACTTC
 
. : . : . : . : . : . :
rJMFF007M06+ ATGGTTCATCTTTGGATTGCTGGGAAAGGACCCCTTTGTTGCTATACCAAATGGTTTTGG
rJMFF049G02+ ATGGTTCATCTTTGGATTGCTGGGAAAGGACCCCTTTGTTGCTATACCAAATGGTTTTGG
                      ____________________________________________________________
consensus ATGGTTCATCTTTGGATTGCTGGGAAAGGACCCCTTTGTTGCTATACCAAATGGTTTTGG
 
. : . : . : . : . : . :
rJMFF007M06+ GTGTGGCTTAGGAGCAGTGCAGTTGATATTGTATGCCATTTACTGTGAGAAGAAATCCTT
rJMFF049G02+ GTGTGGCTTAGGAGCAGTGCAGTTGATATTGTATGCCATTTACTGTGAGAAGAAATCCTT
                      ____________________________________________________________
consensus GTGTGGCTTAGGAGCAGTGCAGTTGATATTGTATGCCATTTACTGTGAGAAGAAATCCTT
 
. : . : . : . : . : . :
rJMFF007M06+ CCCTGATGGCAACCCCGGCGGAGAAGACATACAATTAGGCATAAAAAAGGGCCAGAACCA
rJMFF049G02+ CCCTGATGGCAACCCCGGCGGAGAAGACATACAATTAGGCATAAAAAAGGGCCAGAACCA
                      ____________________________________________________________
consensus CCCTGATGGCAACCCCGGCGGAGAAGACATACAATTAGGCATAAAAAAGGGCCAGAACCA
 
. : . : . : . : . : . :
rJMFF007M06+ GTCAAAGGAGGATCTGGTTTAGATGTGTGTATGTTATGTGACTTCATTCAGACAATTCTA
rJMFF049G02+ GTCAAAGGAGGATCTGGTTTAGATGTGTGTATGTTATGTGACTTCATTCAGACAATTCTA
                      ____________________________________________________________
consensus GTCAAAGGAGGATCTGGTTTAGATGTGTGTATGTTATGTGACTTCATTCAGACAATTCTA
 
. : . : . : . : . : . :
rJMFF007M06+ TGCTTTCTTCTTGTTGATGCTGTAATGGTTTTCTCTAAAGACTCTACTTGTGCATGTAAA
rJMFF049G02+ TGCTTTCTTCTTGTTGATGCTGTAATGGTTTTCTCTAAAGACTCTACTTGTGCATGTAAA
                      ____________________________________________________________
consensus TGCTTTCTTCTTGTTGATGCTGTAATGGTTTTCTCTAAAGACTCTACTTGTGCATGTAAA
 
. : . : . : . : . : . :
rJMFF007M06+ TGATGAATCCTGGCTTCTGATTCCTCATGTTGGATTGCACTCTAGAC
rJMFF049G02+ TGATGAATCCTGGCTTCTGATTCCTCATGTTGGATTGCACTCTAGACTGAAAAAGGTTTT
                      ____________________________________________________________
consensus TGATGAATCCTGGCTTCTGATTCCTCATGTTGGATTGCACTCTAGACTGAAAAAGGTTTT