Previous Contig 010902:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049F24Sequence643010902 (2)gb:AC142210_17440873e-82Solanum demissum chromosome 11 BAC PGEC589 genomic sequence, complete sequence.597010902 (2)gb:AC142210_17440877e-57Solanum demissum chromosome 11 BAC PGEC589 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049F24- AAGGGAGAGGGATTTTGCATTGCGTTGGGTTTCTGCTC
                      ____________________________________________________________
consensus AAGGGAGAGGGATTTTGCATTGCGTTGGGTTTCTGCTC
 
. : . : . : . : . : . :
JMFF049F24- AGTAGTCGCCCGTCCACCCCAAATTTGATCGAGAAAATGAGCGGAACAGCGAAGAAAGTT
                      ____________________________________________________________
consensus AGTAGTCGCCCGTCCACCCCAAATTTGATCGAGAAAATGAGCGGAACAGCGAAGAAAGTT
 
. : . : . : . : . : . :
JMFF049F24- GCCGACGTTACGTTCAAGGCCGGCAAGACAATCGATTGGGAAGGAATGGCGAGGCTTCTC
                      ____________________________________________________________
consensus GCCGACGTTACGTTCAAGGCCGGCAAGACAATCGATTGGGAAGGAATGGCGAGGCTTCTC
 
. : . : . : . : . : . :
JMFF049F24- GTCTCCGATGAGGCTCGGAAGGAGTTCGCTTCCCTCCGCCGCGCCTTCGACGAGGTCAAT
                      ____________________________________________________________
consensus GTCTCCGATGAGGCTCGGAAGGAGTTCGCTTCCCTCCGCCGCGCCTTCGACGAGGTCAAT
 
. : . : . : . : . : . :
JMFF049F24- TCCCAGCTTCAGACCAAGTTTAGCCAGGAACCTGAACCCATAGATTGGGAATATTACAGA
rJMFF049F24+ ACCAAGTTTAGCCAGGAACCTGAACCCATAGATTGGGAATATTACAGA
                      ____________________________________________________________
consensus TCCCAGCTTCAGACCAAGTTTAGCCAGGAACCTGAACCCATAGATTGGGAATATTACAGA
 
. : . : . : . : . : . :
JMFF049F24- AAAGGACTTGGTTCTCGCTTGGTGGATATGTACAAGCAGGCATATGAGAGTATTGAAATC
rJMFF049F24+ AAAGGACTTGGTTCTCGCTTGGTGGATATGTACAAGCAGGCATATGAGAGTATTGAAATC
                      ____________________________________________________________
consensus AAAGGACTTGGTTCTCGCTTGGTGGATATGTACAAGCAGGCATATGAGAGTATTGAAATC
 
. : . : . : . : . : . :
JMFF049F24- CCTAAATACGTGGACACTGTCACTCCCCAATATATGCCCAAGTTTGATGCCCTGGTGGTA
rJMFF049F24+ CCTAAATACGTGGACACTGTCACTCCCCAATATATGCCCAAGTTTGATGCCCTGGTGGTA
                      ____________________________________________________________
consensus CCTAAATACGTGGACACTGTCACTCCCCAATATATGCCCAAGTTTGATGCCCTGGTGGTA
 
. : . : . : . : . : . :
JMFF049F24- GAGCTGAAAGAAGCTGAGCAGAAATCTCTCAAGGAGTCTGCAAGACTAGAAAAAGAAGTT
rJMFF049F24+ GAGCTGAAAGAAGCTGAGCAGAAATCTCTCAAGGAGTCTGCAAGACTAGAAAAAGAAGTT
                      ____________________________________________________________
consensus GAGCTGAAAGAAGCTGAGCAGAAATCTCTCAAGGAGTCTGCAAGACTAGAAAAAGAAGTT
 
. : . : . : . : . : . :
JMFF049F24- GCAGATGTCCAAGAGTTGAAGAAAAAACTCAGTACTATGACAGCAGAAGAATACTTTGCT
rJMFF049F24+ GCAGATGTCCAAGAGTTGAAGAAAAAACTCAGTACTATGACAGCAGAAGAATACTTTGCT
                      ____________________________________________________________
consensus GCAGATGTCCAAGAGTTGAAGAAAAAACTCAGTACTATGACAGCAGAAGAATACTTTGCT
 
. : . : . : . : . : . :
JMFF049F24- AAGCATCCAGAGTTAAAGAAGAAGTTCGATGATGAAATTCGTAATGATTACTGGGGTTAC
rJMFF049F24+ AAGCATCCAGAGTTAAAGAAGAAGTTCGATGATGAAATTCGTAATGATTACTGGGGTTAC
                      ____________________________________________________________
consensus AAGCATCCAGAGTTAAAGAAGAAGTTCGATGATGAAATTCGTAATGATTACTGGGGTTAC
 
. : . : . : . : . : . :
JMFF049F24- TAGT
rJMFF049F24+ TAGTTGACTTGATGTAGCTGCCTGCTTTATTGCCTTGGTGGACTTTTATTTCGTTCATCA
                      ____________________________________________________________
consensus TAGTTGACTTGATGTAGCTGCCTGCTTTATTGCCTTGGTGGACTTTTATTTCGTTCATCA
 
. : . : . : . : . : . :
rJMFF049F24+ TTGGTTTAGAAATAAAAGAGAATTAATTGGTTCCCCGTTCCATCTACGGGTTGAGTTGAA
                      ____________________________________________________________
consensus TTGGTTTAGAAATAAAAGAGAATTAATTGGTTCCCCGTTCCATCTACGGGTTGAGTTGAA
 
. : . : . : . : . : . :
rJMFF049F24+ GAATGTCAAATAGATTACATATTTTTGAGGTGTCATTGCATACTTTCGCTTAAGGAACCA
                      ____________________________________________________________
consensus GAATGTCAAATAGATTACATATTTTTGAGGTGTCATTGCATACTTTCGCTTAAGGAACCA
 
. : . : . : . : . : . :
rJMFF049F24+ AATATTTTCCAGTTAAAAATGGAATATTAGATCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AATATTTTCCAGTTAAAAATGGAATATTAGATCAAAAAAAAAAAAAAAACTCTCCAGGGT