Previous Contig 010900:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016I04Sequence604007331 (4)sp|Q42885|ARC2_LYCES3e-75Chorismate synthase 2, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima749010900 (4)sp|Q42884|ARC1_LYCES7e-77Chorismate synthase 1, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima
JMFF049F15Sequence621007331 (4)sp|Q42885|ARC2_LYCES8e-78Chorismate synthase 2, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima341010900 (4)
JMSF024C24Sequence612019336sp|Q42885|ARC2_LYCES5e-63Chorismate synthase 2, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima776010900 (4)sp|Q42884|ARC1_LYCESe-103Chorismate synthase 1, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima
JMSF039P16Sequence671007331 (4)sp|Q42885|ARC2_LYCES8e-55Chorismate synthase 2, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima849010900 (4)sp|Q42884|ARC1_LYCESe-100Chorismate synthase 1, chloroplast precursor (EC 4.2.3.5) (5- enolpyruvylshikima

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024C24+ A
rJMSF039P16+ ATCAGATTNGAAAACCATATTNGCCGA
                      ____________________________________________________________
consensus ATCAGATTNGAAAACCATATTNGCCGA
 
. : . : . : . : . : . :
rJMSF024C24+ TGCCCAGATCCTGAATACGCAGAAAAGATGATAGCTGCCA-TTGATGCTGTTCGTGTAAA
rJMSF039P16+ TGCCCAGATCCTGAATACGCAGAAAAGATGATAGCTGCCATTTGATGCTGTTCGTGTAAA
                      ____________________________________________________________
consensus TGCCCAGATCCTGAATACGCAGAAAAGATGATAGCTGCCATTTGATGCTGTTCGTGTAAA
 
. : . : . : . : . : . :
rJMSF024C24+ GGGAGATTCTGTTGGTGGTGTAGTTACTTGCATCGTCAGGAATGCTCCACGGGGTCTTGG
rJMSF039P16+ GGGAGATTCTGTTGGTGGTGTAGTTACTTGCATCGTCAGGAATGCTCCACGGGGTCTTGG
                      ____________________________________________________________
consensus GGGAGATTCTGTTGGTGGTGTAGTTACTTGCATCGTCAGGAATGCTCCACGGGGTCTTGG
 
. : . : . : . : . : . :
rJMSF024C24+ ATATCCCGTATTTGATAAACTTGAAGCTGAGCTTGCTAAAGCTTGCATGTCGTTACCTGC
rJMSF039P16+ ATATCCCGTATTTGATAAACTTGAAGCTGAGCTTGCTAAAGCTTGCATGTCGTTACCTGC
rJMFF016I04+ GAAGCTGAGCTTGCTAAAGCTTGCATGTCGTTACCTGC
                      ____________________________________________________________
consensus ATATCCCGTATTTGATAAACTTGAAGCTGAGCTTGCTAAAGCTTGCATGTCGTTACCTGC
 
. : . : . : . : . : . :
rJMSF024C24+ AACAAAAGGATTTGAGTTTGGCAGTGGGTTTGCAGGCACATTCATGACTGGTAGTGAACA
rJMSF039P16+ AACAAAAGGATTTGAGTTTGGCAGTGGGTTTGCAGGCACATTCATGACTGGTAGTGAACA
rJMFF016I04+ AACAAAAGGATTTGAGTTTGGCAGTGGGTTTGCAGGCACATTCATGACTGGTAGTGAACA
                      ____________________________________________________________
consensus AACAAAAGGATTTGAGTTTGGCAGTGGGTTTGCAGGCACATTCATGACTGGTAGTGAACA
 
. : . : . : . : . : . :
rJMSF024C24+ CAATGATGAATTTTATATGGATGAACATGGTAAAATCAGGACAAGAACCAACCGATCTGG
rJMSF039P16+ CAATGATGAATTTTATATGGATGAACATGGTAAAATCAGGACAAGAACCAACCGATCTGG
rJMFF016I04+ CAATGATGAATTTTATATGGATGAACATGGTAAAATCAGGACAAGAACCAACCGATCTGG
                      ____________________________________________________________
consensus CAATGATGAATTTTATATGGATGAACATGGTAAAATCAGGACAAGAACCAACCGATCTGG
 
. : . : . : . : . : . :
rJMSF024C24+ TGGGATACAGGGTGGAATATCAAATGGAGAAGTTATTAATATGAGAATAGCTTTCAAGCC
rJMSF039P16+ TGGGATACAGGGTGGAATATCAAATGGAGAAGTTATTAATATGAGAATAGCTTTCAAGCC
rJMFF016I04+ TGGGATACAGGGTGGAATATCAAATGGAGAAGTTATTAATATGAGAATAGCTTTCAAGCC
                      ____________________________________________________________
consensus TGGGATACAGGGTGGAATATCAAATGGAGAAGTTATTAATATGAGAATAGCTTTCAAGCC
 
. : . : . : . : . : . :
rJMSF024C24+ TACATCTACAATCTCAAGGAAGCAGAATACAGTGACAAGAGACAAACACGAGACTGAGCT
rJMSF039P16+ TACATCTACAATCTCAAGGAAGCAGAATACAGTGACAAGAGACAAACACGAGACTGAGCT
rJMFF016I04+ TACATCTACAATCTCAAGGAAGCAGAATACAGTGACAAGAGACAAACACGAGACTGAGCT
                      ____________________________________________________________
consensus TACATCTACAATCTCAAGGAAGCAGAATACAGTGACAAGAGACAAACACGAGACTGAGCT
 
. : . : . : . : . : . :
rJMSF024C24+ CATTGCTCGTGGTCGACATGATCCTTGTGTAGTGCCTCGAGCTGTTCCAATGGTGGAAGC
rJMSF039P16+ CATTGCTCGTGGTCGACATGATCCTTGTGTAGTGCCTCGAGCTGTTCCAATGGTGGAAGC
rJMFF016I04+ CATTGCTCGTGGTCGACATGATCCTTGTGTAGTGCCTCGAGCTGTTCCAATGGTGGAAGC
                      ____________________________________________________________
consensus CATTGCTCGTGGTCGACATGATCCTTGTGTAGTGCCTCGAGCTGTTCCAATGGTGGAAGC
 
. : . : . : . : . : . :
rJMSF024C24+ CATGGTAGCCCTTGTGCTTGTTGATCAACTAATGGCACAATATGCTCAATGCATGCTTTT
rJMSF039P16+ CATGGTAGCCCTTGTGCTTGTTGATCAACTAATGGCACAATATGCTCAATGCATGCTTTT
rJMFF016I04+ CATGGTAGCCCTTGTGCTTGTTGATCAACTAATGGCACAATATGCTCAATGCATGCTTTT
                      ____________________________________________________________
consensus CATGGTAGCCCTTGTGCTTGTTGATCAACTAATGGCACAATATGCTCAATGCATGCTTTT
 
. : . : . : . : . : . :
rJMSF024C24+ TCCAATAAACCCTGCATTACAGGAGCCCCTGCAATCAAACTCCGAGCCAGCAGCTGCTAA
rJMSF039P16+ TCCAATAAACCCTGCATTACAGGAGCCCCTGCAATCAAACTCCGAGCCAGCAGCTGCTAA
rJMFF016I04+ TCCAATAAACCCTGCATTACAGGAGCCCCTGCAATCAAACTCCGAGCCAGCAGCTGCTAA
rJMFF049F15+ CAGGAGCCCCTGCAATCAAACTCCGAGCCAGCAGCTGTTAA
                      ____________________________________________________________
consensus TCCAATAAACCCTGCATTACAGGAGCCCCTGCAATCAAACTCCGAGCCAGCAGCTGCTAA
 
. : . : . : . : . : . :
rJMSF024C24+ TGTTGCCCTTTGAATGGTTGGTCGCAAAATGCTGTCTACTTCATTGCTATGTTTTAGCTT
rJMSF039P16+ TGTTGCCCTTTGAATGGTTGGTCGCAAAATGCTGTCTACTTCATTGCTATGTTTTAGCTT
rJMFF016I04+ TGTTGCCCTTTGAATGGTTGGTCGCAAAATGCTGTCTACTTCATTGCTATGTTTTAGCTT
rJMFF049F15+ TGTTGCCCTTTGAATGGTTGGTCGCAAAATGCTGTCTACTTCATTGCTATGTTTTAGCTT
                      ____________________________________________________________
consensus TGTTGCCCTTTGAATGGTTGGTCGCAAAATGCTGTCTACTTCATTGCTATGTTTTAGCTT
 
. : . : . : . : . : . :
rJMSF024C24+ TGCTTCACCCAACGTGTGCAAGTTTTGTTTGAAGGCTATATCATACCACCATACCTATAC
rJMSF039P16+ TGCTTCACCCAACGTGTGCAAGTTTTGTTTGAAGGCTATATCATACCACCATACCTATAC
rJMFF016I04+ TGCTTCACCCAACGTGTGCAAGTTTTGTTTGAAGGCTATATCATACCACCATACCTATAC
rJMFF049F15+ TGCTTCACCCAACGTGTGCAAGTTTTGTTTGAAGGCTATATCATACCCCCATACCTATAC
                      ____________________________________________________________
consensus TGCTTCACCCAACGTGTGCAAGTTTTGTTTGAAGGCTATATCATACCACCATACCTATAC
 
. : . : . : . : . : . :
rJMSF024C24+ TCTGAACACTCTATTATGTATTATTCGGCGATTACAATTGTATTGCT
rJMSF039P16+ TCTGAACACTCTATTATGTATTATTCGGCGATTACAATTGTATTGCTTTTGGATCTCTCT
rJMFF016I04+ TCTGAACACTCTATTATGTATTATTCGGCGATTACAATTGTATTGCTTTTGGATCTCTCT
rJMFF049F15+ TTTGAACACTTTATTATGTATTATTCGGCGATTACAATTGTATTGCTTTTGGATCTCTCT
                      ____________________________________________________________
consensus TCTGAACACTCTATTATGTATTATTCGGCGATTACAATTGTATTGCTTTTGGATCTCTCT
 
. : . : . : . : . : . :
rJMSF039P16+ ATTATATTGTAGGTTGTTGATTAAA
rJMFF016I04+ ATTATATTGTAGGTTGTTGATTAAACACAGTGGCAGGGCTTGTAGGAAGAATAAGGCCTT
rJMFF049F15+ ATTATATTGTAGGTTGTTGATTAAACCCAGTGGCAGGGCTTGTAGGAAGAATAAGGCCTT
                      ____________________________________________________________
consensus ATTATATTGTAGGTTGTTGATTAAACCCAGTGGCAGGGCTTGTAGGAAGAATAAGGCCTT
 
. : . : . : . : . : . :
rJMFF016I04+ TAATTGGCAATTTTAGGTTTTTTCTACCATTTTCACCGAGACCAAT
rJMFF049F15+ TAATTGGCAATTTTAGGTTTTTTTTACCATTTTCCCCGAGACCAATTGAATTTATACTTT
                      ____________________________________________________________
consensus TAATTGGCAATTTTAGGTTTTTTTTACCATTTTCCCCGAGACCAATTGAATTTATACTTT