Previous Contig 010893:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049E03Sequence490010893 (4)gb:AB016874_15129431e-43Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20.>gb:ATAC002342_365010893 (4)gb:AP003628_18317131e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMSF049I22Sequence706010893 (4)gb:AB016874_15129434e-75Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20.>gb:ATAC002342_732010893 (4)gb:AP003628_18317131e-99Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049E03- ACTTGTGAATGTATAT
JMSF049I22- GGCTAGGATTTCTTCTCTCTGTGAACTTGTGAATGTATAT
                      ____________________________________________________________
consensus GGCTAGGATTTCTTCTCTCTGTGAACTTGTGAATGTATAT
 
. : . : . : . : . : . :
JMFF049E03- ACGCGTGTCCAAAAAATCAAGCTTTTCACAGAAAAAATGGCTTTTTGTGCGACGCAACAG
JMSF049I22- ACG-GTGTCCAAAAAATCAAGCTTTTCACAGAAAAAATGGCTTTTTGTGCGACGCAACAG
                      ____________________________________________________________
consensus ACGCGTGTCCAAAAAATCAAGCTTTTCACAGAAAAAATGGCTTTTTGTGCGACGCAACAG
 
. : . : . : . : . : . :
JMFF049E03- TGATTGGTACTCGTTTCGGCTTCTGGAGCGGTTGGGGTGCTGATAAAGCCGCTATCCTCA
JMSF049I22- TGATTGGTACTCGTTTCGGCTTCTGGAGCGGTTGGGGTGCTGATAAAGCCGCTATCCTCA
                      ____________________________________________________________
consensus TGATTGGTACTCGTTTCGGCTTCTGGAGCGGTTGGGGTGCTGATAAAGCCGCTATCCTCA
 
. : . : . : . : . : . :
JMFF049E03- CCCTAACACAAGGTTTTGTTGAGTCTCAAATATAGTTCAGAATTTGGGCACCAGAAGCTC
JMSF049I22- CCCTAACACAAGGTTTTGTTGAGTCTCAAATATAGTTCAGAATTTGGGCACCAGAAGCTC
                      ____________________________________________________________
consensus CCCTAACACAAGGTTTTGTTGAGTCTCAAATATAGTTCAGAATTTGGGCACCAGAAGCTC
 
. : . : . : . : . : . :
JMFF049E03- GAGAGTTCCAACATCTTTACCATGTCTATGCTGAAAAGGTTACGTTGTGTCACACTCGAT
JMSF049I22- GAGAGTTCCAACATCTTTACCATGTCTATGCTGAAAAGGTTACGTTGTGTCACACTCGAT
                      ____________________________________________________________
consensus GAGAGTTCCAACATCTTTACCATGTCTATGCTGAAAAGGTTACGTTGTGTCACACTCGAT
 
. : . : . : . : . : . :
JMFF049E03- GTTACTGGTACACTGATCGCTTACAAAGGAGAGCTAGGTGACTACTATTGCATGGCAGCC
JMSF049I22- GTTACTGGTACACTGATCGCTTACAAAGGAGAGCTAGGTGACTACTATTGCATGGCAGCC
                      ____________________________________________________________
consensus GTTACTGGTACACTGATCGCTTACAAAGGAGAGCTAGGTGACTACTATTGCATGGCAGCC
 
. : . : . : . : . : . :
JMFF049E03- AAAGCCGTGGGACTTCCATGCCCCGACTACAAAAGAGTGCACGAGGGCTTTAAACTCGCT
JMSF049I22- AAAGCCGTGGGACTTCCATGCCCCGACTACAAAAGAGTGCACGAGGGCTTTAAACTCGCT
rJMSF049I22+ CAAAAGAGTGCACGAGGGCTTTAAACTCGCT
                      ____________________________________________________________
consensus AAAGCCGTGGGACTTCCATGCCCCGACTACAAAAGAGTGCACGAGGGCTTTAAACTCGCT
 
. : . : . : . : . : . :
JMFF049E03- TATACAGACATGGCAAGAAAACATCCATGCTTCGGGTTTGCAGAAAAGATCCCGAACATT
JMSF049I22- TATACAGACATGGCAAGAAAACATCCATGCTTCGGGTTTGCAGAAAAGATCCCGAACATT
rJMSF049I22+ TATACAGACATGGCAAGAAAACATCCATGCTTCGGGTTTGCAGAAAAGATCCCGAACATT
                      ____________________________________________________________
consensus TATACAGACATGGCAAGAAAACATCCATGCTTCGGGTTTGCAGAAAAGATCCCGAACATT
 
. : . : . : . : . : . :
JMFF049E03- ATCTGGTGGAAGACTTGTGTGCGAGATTCATTTGTGAAGGCTGGATATGA
JMSF049I22- ATCTGGTGGAAGACTTGTGTGCGAGATTCATTTGTGAAGGCTGGATATGATTATGACGAG
rJMSF049I22+ ATCTGGTGGAAGACTTGTGTGCGAGATTCATTTGTGAAGGCTGGATATGATTATGACGAG
                      ____________________________________________________________
consensus ATCTGGTGGAAGACTTGTGTGCGAGATTCATTTGTGAAGGCTGGATATGATTATGACGAG
 
. : . : . : . : . : . :
JMSF049I22- GAGACTTTTGAAAAGATCTTTAGACGCATATATGCAACGTTTGGTTCCTCTGCACCGTAC
rJMSF049I22+ GAGACTTTTGAAAAGATCTTTAGACGCATATATGCAACGTTTGGTTCCTCTGCACCGTAC
                      ____________________________________________________________
consensus GAGACTTTTGAAAAGATCTTTAGACGCATATATGCAACGTTTGGTTCCTCTGCACCGTAC
 
. : . : . : . : . : . :
JMSF049I22- ACTATTTTCCCAGATGCCCAACCGTTCCTAAGGTGGCTTCGTTCTACAGGGGTTACAGTC
rJMSF049I22+ ACTATTTTCCCAGATGCCCAACCGTTCCTAAGGTGGCTTCGTTCTACAGGGGTTACAGTC
                      ____________________________________________________________
consensus ACTATTTTCCCAGATGCCCAACCGTTCCTAAGGTGGCTTCGTTCTACAGGGGTTACAGTC
 
. : . : . : . : . : . :
JMSF049I22- GGGCTTGTCAGCAACGCTGAGTATCGGTATCAAGATGTAATCCTCCCAGCGCTCGGTTTG
rJMSF049I22+ GGGCTTGTCAGCAACGCTGAGTATCGGTATCAAGATGTAATCCTCCCAGCGCTCGGTTTG
                      ____________________________________________________________
consensus GGGCTTGTCAGCAACGCTGAGTATCGGTATCAAGATGTAATCCTCCCAGCGCTCGGTTTG
 
. : . : . : . : . : . :
JMSF049I22- AATCAGG
rJMSF049I22+ AATCAGGGATCGGAGTGGGATTTTGGCGTATTCTCTGGGCTAGAAGGTGTAGAAAAGCCA
rJMFF049E03+ AGCCA
                      ____________________________________________________________
consensus AATCAGGGATCGGAGTGGGATTTTGGCGTATTCTCTGGGCTAGAAGGTGTAGAAAAGCCA
 
. : . : . : . : . : . :
rJMSF049I22+ GACCCGAAGATCTATCGGATTGCGTTGGAGAGAGCTGGAAACGTCGCGCCCGAAGAAGTT
rJMFF049E03+ GACCCGAAGATCTATCGGATTGCGTTGGAGAGAGCTGGAAACGTCGCGCCCGAAGAAGTT
                      ____________________________________________________________
consensus GACCCGAAGATCTATCGGATTGCGTTGGAGAGAGCTGGAAACGTCGCGCCCGAAGAAGTT
 
. : . : . : . : . : . :
rJMSF049I22+ CTGCACATCGGGGACAGCATGCGAAAAGATTTCGTACCGGCTACGAGTGTGGGGATGCAT
rJMFF049E03+ CTGCACATCGGGGACAGCATGCGAAAAGATTTCGTACCGGGTACGAGTGTGGGGATGCAT
                      ____________________________________________________________
consensus CTGCACATCGGGGACAGCATGCGAAAAGATTTCGTACCGGGTACGAGTGTGGGGATGCAT
 
. : . : . : . : . : . :
rJMSF049I22+ GCAATATTGCTTGACAGGTTCAAGACAGCTGATGCTGAAAATTGGAAGAAATCTGGAGCC
rJMFF049E03+ GCAATATTGCTTGACAGGTTCAAGACAGCTGATGCTGAAAATTGGAAGAAATCTGGAGCC
                      ____________________________________________________________
consensus GCAATATTGCTTGACAGGTTCAAGACAGCTGATGCTGAAAATTGGAAGAAATCTGGAGCC
 
. : . : . : . : . : . :
rJMSF049I22+ ATAGTGCTGCCTGATCTGGTAGCAGCAAAAGAATGGCTTACTTCTCAACAATTGCATTCC
rJMFF049E03+ ATAGTGCTGCCTGATCTGGTAGCAGCAAAAGAATGGCTTACTTCTCAACAATTGCATTCC
                      ____________________________________________________________
consensus ATAGTGCTGCCTGATCTGGTAGCAGCAAAAGAATGGCTTACTTCTCAACAATTGCATTCC
 
. : . : . : . : . : . :
rJMSF049I22+ TGAGTAATTAGTTATATTGTTGTTCTAATTTATATCTGGTTTTATGCTGTATTTGCACTG
rJMFF049E03+ TGAGTAATTAGTTATATTGTTGTTCTACTTTATATCTGGTTTTATGCTGTATTTGCACTG
                      ____________________________________________________________
consensus TGAGTAATTAGTTATATTGTTGTTCTACTTTATATCTGGTTTTATGCTGTATTTGCACTG
 
. : . : . : . : . : . :
rJMSF049I22+ AGAAAAGAAAATGAATAGACAGACATTT
rJMFF049E03+ AGAAAAGAAAATGAATAGACAGACATTTTTAAAGAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AGAAAAGAAAATGAATAGACAGACATTTTTAAAGAAAAAAAAAAAAAAACTCTCCAGGGT