Previous Contig 010886:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025F01Sequence526001203 (3)pir|T45824|T458243e-18hypothetical protein F2K15.50 - Arabidopsis thaliana>gb:ATF2K15_1550525 Arabidop740010886 (3)gb:AK118253_18162403e-43Arabidopsis thaliana At5g53390 mRNA for unknown protein, complete cds, clone: RA
JMFF047G17Sequence415001203 (3)pir|T45824|T458242e-14hypothetical protein F2K15.50 - Arabidopsis thaliana>gb:ATF2K15_1550525 Arabidop173010886 (3)
JMFF049D02Sequence628001203 (3)gb:AB013388_15120385e-26Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1.654010886 (3)gb:AP003106_18247668e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025F01+ CTATTTTTCAATCTT
                      ____________________________________________________________
consensus CTATTTTTCAATCTT
 
. : . : . : . : . : . :
rJMFF025F01+ AGACCAGCAAAAGGAATTCAGGCGTTAGCAGACATGATGAAGAAGGAGAAGGGAGAAAGC
                      ____________________________________________________________
consensus AGACCAGCAAAAGGAATTCAGGCGTTAGCAGACATGATGAAGAAGGAGAAGGGAGAAAGC
 
. : . : . : . : . : . :
rJMFF025F01+ AATTCGATGTCGAAGTGGGGTTGGGGAAACCGTTTTGGTTATGCAATCCTACCCTTAAAA
                      ____________________________________________________________
consensus AATTCGATGTCGAAGTGGGGTTGGGGAAACCGTTTTGGTTATGCAATCCTACCCTTAAAA
 
. : . : . : . : . : . :
rJMFF025F01+ ATTGGAATGCTGAATGATCCCTTGGATTATGTGAGAGAAGCCAAGGCAACCGCTGACCGC
rJMFF049D02+ ATGCTGAATGATCCCTTGGATTATGTGAGAGAAGCCAAGGCAACCGCTGACCGC
                      ____________________________________________________________
consensus ATTGGAATGCTGAATGATCCCTTGGATTATGTGAGAGAAGCCAAGGCAACCGCTGACCGC
 
. : . : . : . : . : . :
rJMFF025F01+ AAGAAATACTCATATGAACCTATTTTCACTTATTACCTTGCCAATTTCGTCATTAAATTT
rJMFF049D02+ AAGAAATACTCATATGAACCTATTTTCACTTATTACCTTGCCAATTTCGTCATTAAATTT
                      ____________________________________________________________
consensus AAGAAATACTCATATGAACCTATTTTCACTTATTACCTTGCCAATTTCGTCATTAAATTT
 
. : . : . : . : . : . :
rJMFF025F01+ TTTGGCCCCAAGGCAGCCGCCATTTTGACGAACAAAATATTCAGCAACGCAAGCACGTGC
rJMFF049D02+ TTTGGCCCCAAGGCAGCCGCCATTTTGACGAACAAAATATTCAGCAACGCAAGCACGTGC
                      ____________________________________________________________
consensus TTTGGCCCCAAGGCAGCCGCCATTTTGACGAACAAAATATTCAGCAACGCAAGCACGTGC
 
. : . : . : . : . : . :
rJMFF025F01+ TTCTCCAACGTTGTTGGACCTCGAGAAGATCTTGAGTTCTTTGGTCACCCCATTGCCTTT
rJMFF049D02+ TTCTCCAACGTTGTTGGACCTCGAGAAGATCTTGAGTTCTTTGGTCACCCCATTGCCTTT
                      ____________________________________________________________
consensus TTCTCCAACGTTGTTGGACCTCGAGAAGATCTTGAGTTCTTTGGTCACCCCATTGCCTTT
 
. : . : . : . : . : . :
rJMFF025F01+ ATAGCTCCTACTTGTTATGGCCAGCCAAGTGCTCTGATGGTTCACTTTCAAAGTTATGTG
rJMFF049D02+ ATAGCTCCTACTTGTTATGGCCAGCCAAGTGCTCTGATGGTTCACTTTCAAAGTTATGTG
                      ____________________________________________________________
consensus ATAGCTCCTACTTGTTATGGCCAGCCAAGTGCTCTGATGGTTCACTTTCAAAGTTATGTG
 
. : . : . : . : . : . :
rJMFF025F01+ GACAAGATGGGTGTTATTATATCCGTTGATGAGAATGTGATTCCTGATCCCAACCAGTTG
rJMFF049D02+ GACAAGATGGGTGTTATTATATCCGTTGATGAGAATGTGATTCCTGATCCCAACCAGTTG
                      ____________________________________________________________
consensus GACAAGATGGGTGTTATTATATCCGTTGATGAGAATGTGATTCCTGATCCCAACCAGTTG
 
. : . : . : . : . : . :
rJMFF025F01+ CTGGATGATTTTGAGAAATCCCTTCATCTCATTAAGGATGCTGCTGCAGCTGCCGCCACA
rJMFF049D02+ CTGGATGATTTTGAGAAATCCCTTCATCTCATTAAGGATGCTGCTGCAGCTGCCGCCACA
                      ____________________________________________________________
consensus CTGGATGATTTTGAGAAATCCCTTCATCTCATTAAGGATGCTGCTGCAGCTGCCGCCACA
 
. : . : . : . : . : . :
rJMFF025F01+ TCATCACCAACCAATTTATAATTAAGCCGCGCGCTAAGCTATATGTTGTATTGAAGATCA
rJMFF047G17+ AAGCTATATGTTGTATTGAAGATCA
rJMFF049D02+ TCATCACCAACCAATTTATAATTAAGCCGCGCGCTAAGCTATATGTTGTATTGAAGATCA
                      ____________________________________________________________
consensus TCATCACCAACCAATTTATAATTAAGCCGCGCGCTAAGCTATATGTTGTATTGAAGATCA
 
. : . : . : . : . : . :
rJMFF025F01+ GATCAGATCAGATGTCAAGTAATAATTAAATTAATAAGCTGCATGATGAAATGCATCAAC
rJMFF047G17+ GATCAGATCAGATGTCAAGTAATAATTAAATTAATAAGCTGCATGATGAAATGCATCAAC
rJMFF049D02+ GATCAGATCAGATGTCAAGTAATAATTAAATTAATAAGCTGCATGATGAAATGCATCAAC
                      ____________________________________________________________
consensus GATCAGATCAGATGTCAAGTAATAATTAAATTAATAAGCTGCATGATGAAATGCATCAAC
 
. : . : . : . : . : . :
rJMFF025F01+ GTACCTAGCTACTGTATGTATAATATGCTGTATGTGTGATTGTGTGCTAGCTTAAGTTTA
rJMFF047G17+ GTCCCTAGCTACTGTATGTATAATATGCTGTATGTGGGATTGTGTGCTAGCTTAAGTTTA
rJMFF049D02+ GTACCTAGCTACTGTATGTATAATATGCTGTATGTGTGATTGTGTGCTAGCTTAAGTTTA
                      ____________________________________________________________
consensus GTACCTAGCTACTGTATGTATAATATGCTGTATGTGTGATTGTGTGCTAGCTTAAGTTTA
 
. : . : . : . : . : . :
rJMFF025F01+ ATTT
rJMFF047G17+ ATTTTGTAATAA
rJMFF049D02+ ATTTTGTAATAAAAAAAAAGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATTTTGTAATAAAAAAAAAGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG